\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122438429:

Variant ID: vg0122438429 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22438429
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTGTTACCCAAAATACTGAGTCAAGTGGCTCCAGTTTCAGGGAACTCTGGCATTTTAACATCATTGGCGGCTTGGCGCTACTGGAGATTTTCTTTTAA[C/G]
TAATTCTTGCCTCGAAGTTCTTTGTCTATTTTGGTTTTTTTTAAGGAGGCTGCTATACCACGGGATTCTGTCCAAACGGTATGATACTAAGCAAGTATCA

Reverse complement sequence

TGATACTTGCTTAGTATCATACCGTTTGGACAGAATCCCGTGGTATAGCAGCCTCCTTAAAAAAAACCAAAATAGACAAAGAACTTCGAGGCAAGAATTA[G/C]
TTAAAAGAAAATCTCCAGTAGCGCCAAGCCGCCAATGATGTTAAAATGCCAGAGTTCCCTGAAACTGGAGCCACTTGACTCAGTATTTTGGGTAACAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 16.50% 3.22% 23.87% NA
All Indica  2759 30.40% 27.40% 5.36% 36.79% NA
All Japonica  1512 96.30% 0.00% 0.07% 3.64% NA
Aus  269 80.30% 2.60% 0.00% 17.10% NA
Indica I  595 7.70% 2.70% 13.78% 75.80% NA
Indica II  465 12.70% 37.40% 4.95% 44.95% NA
Indica III  913 56.00% 35.90% 0.77% 7.34% NA
Indica Intermediate  786 28.50% 30.30% 4.58% 36.64% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 89.90% 0.00% 0.00% 10.12% NA
Japonica Intermediate  241 98.30% 0.00% 0.41% 1.24% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 68.90% 14.40% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122438429 C -> G LOC_Os01g39780.1 downstream_gene_variant ; 37.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Callus, score: 90.024 N N N N
vg0122438429 C -> G LOC_Os01g39790.1 downstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Callus, score: 90.024 N N N N
vg0122438429 C -> G LOC_Os01g39790.2 downstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:49.01; most accessible tissue: Callus, score: 90.024 N N N N
vg0122438429 C -> G LOC_Os01g39780-LOC_Os01g39790 intergenic_region ; MODIFIER silent_mutation Average:49.01; most accessible tissue: Callus, score: 90.024 N N N N
vg0122438429 C -> DEL N N silent_mutation Average:49.01; most accessible tissue: Callus, score: 90.024 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122438429 NA 6.87E-09 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 3.92E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 1.60E-11 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 9.46E-08 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 3.53E-06 3.21E-11 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 3.86E-07 3.86E-07 mr1875 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 1.94E-07 4.16E-12 mr1908 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 9.98E-07 4.76E-08 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 2.99E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 2.38E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 7.56E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 1.93E-09 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 1.65E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 3.80E-06 1.56E-11 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 2.01E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 5.12E-06 3.99E-11 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 3.26E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 1.35E-06 3.66E-12 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 2.68E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122438429 NA 1.62E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251