Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122413949:

Variant ID: vg0122413949 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22413949
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAAAAAATGGTAAAAGTGAATGATGGATAGTTGTGATTGGTTGAATAGTGGAGGTAGGTGAAAAAAGTGAATGGTGGAGGATTGTAATTGGTTGGGAA[A/G]
AGAATGTTGGCGAAGAAGTTGTTATATTTTAGGACAAATCTTTAGGACTAAAAATTGTTATATTTTGGAAAGGATGGAGTACAAACTTATGATGCTGATT

Reverse complement sequence

AATCAGCATCATAAGTTTGTACTCCATCCTTTCCAAAATATAACAATTTTTAGTCCTAAAGATTTGTCCTAAAATATAACAACTTCTTCGCCAACATTCT[T/C]
TTCCCAACCAATTACAATCCTCCACCATTCACTTTTTTCACCTACCTCCACTATTCAACCAATCACAACTATCCATCATTCACTTTTACCATTTTTTTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 19.70% 0.68% 26.91% NA
All Indica  2759 24.70% 32.90% 1.01% 41.43% NA
All Japonica  1512 95.30% 0.00% 0.07% 4.63% NA
Aus  269 79.60% 1.90% 0.74% 17.84% NA
Indica I  595 3.70% 3.00% 2.02% 91.26% NA
Indica II  465 10.30% 39.10% 1.29% 49.25% NA
Indica III  913 45.50% 48.00% 0.11% 6.46% NA
Indica Intermediate  786 24.90% 34.20% 1.15% 39.69% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 86.70% 0.00% 0.20% 13.10% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 65.60% 21.10% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122413949 A -> G LOC_Os01g39740.1 upstream_gene_variant ; 2540.0bp to feature; MODIFIER silent_mutation Average:44.934; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0122413949 A -> G LOC_Os01g39760.1 upstream_gene_variant ; 3638.0bp to feature; MODIFIER silent_mutation Average:44.934; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0122413949 A -> G LOC_Os01g39750.1 downstream_gene_variant ; 743.0bp to feature; MODIFIER silent_mutation Average:44.934; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0122413949 A -> G LOC_Os01g39750-LOC_Os01g39760 intergenic_region ; MODIFIER silent_mutation Average:44.934; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N
vg0122413949 A -> DEL N N silent_mutation Average:44.934; most accessible tissue: Minghui63 panicle, score: 95.218 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122413949 A G -0.01 0.0 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122413949 NA 3.64E-08 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 NA 3.40E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 NA 4.96E-11 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 NA 6.25E-08 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 7.95E-06 2.55E-10 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 2.94E-07 2.94E-07 mr1875 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 2.62E-07 2.06E-11 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 4.23E-07 2.78E-08 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 NA 8.38E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 NA 4.24E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 NA 3.65E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 8.92E-06 3.73E-09 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 NA 7.83E-07 mr1380_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 3.32E-06 9.47E-11 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 8.48E-06 1.40E-07 mr1561_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 2.84E-06 1.67E-10 mr1875_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 6.20E-06 2.00E-06 mr1875_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 1.03E-06 2.22E-11 mr1908_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 5.26E-06 2.10E-07 mr1908_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122413949 NA 1.51E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251