Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122408539:

Variant ID: vg0122408539 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22408539
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCAGGCGTCCTCCGAGAACGAGAGAACCCTTCACGAAAGAACTCGAGGTGCAGCTGCGGGCTGTGATCTCGGATGCAGGCTAGCACGTGTCCTCCGCG[C/T]
GTAGCGGCTCGCTCGACGGCACTCCTGCTTCAGGGCCTCGTCGATGCGCTTGCCAATCCCATCGAGTTCGGCACAGGCCCCCTTCATCCACGAGATGTAA

Reverse complement sequence

TTACATCTCGTGGATGAAGGGGGCCTGTGCCGAACTCGATGGGATTGGCAAGCGCATCGACGAGGCCCTGAAGCAGGAGTGCCGTCGAGCGAGCCGCTAC[G/A]
CGCGGAGGACACGTGCTAGCCTGCATCCGAGATCACAGCCCGCAGCTGCACCTCGAGTTCTTTCGTGAAGGGTTCTCTCGTTCTCGGAGGACGCCTGGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	16.90%	0.08%	0.00%	NA
All Indica	2759	86.30%	13.70%	0.00%	0.00%	NA
All Japonica	1512	74.00%	25.70%	0.26%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	74.30%	25.70%	0.00%	0.00%	NA
Indica Intermediate	786	84.90%	15.10%	0.00%	0.00%	NA
Temperate Japonica	767	96.60%	3.00%	0.39%	0.00%	NA
Tropical Japonica	504	54.40%	45.60%	0.00%	0.00%	NA
Japonica Intermediate	241	43.20%	56.40%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122408539	C -> T	LOC_Os01g39750.1	upstream_gene_variant ; 3939.0bp to feature; MODIFIER	silent_mutation	Average:56.435; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0122408539	C -> T	LOC_Os01g39720.1	downstream_gene_variant ; 3885.0bp to feature; MODIFIER	silent_mutation	Average:56.435; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0122408539	C -> T	LOC_Os01g39730.1	downstream_gene_variant ; 1318.0bp to feature; MODIFIER	silent_mutation	Average:56.435; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0122408539	C -> T	LOC_Os01g39740.1	intron_variant ; MODIFIER	silent_mutation	Average:56.435; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122408539	NA	1.61E-06	mr1380	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	2.72E-06	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	3.81E-06	7.10E-08	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	6.02E-06	4.69E-10	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	1.40E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	3.66E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	5.12E-07	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	4.96E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	2.22E-06	2.22E-06	mr1996	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	7.22E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	4.78E-08	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	8.59E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	2.95E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	2.84E-09	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	2.38E-07	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	7.04E-09	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122408539	NA	1.94E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251