Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122407829:

Variant ID: vg0122407829 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22407829
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

GGACCATACACGATCACGCAAGTCTTGCGGCCGGGCGCATTCAAGATTGCAGACGGCGATGGCCGCAAGTTAGCAAATTCTTGGAACATTGATCAATTAC[G/A]
TAAATTTTATGTATAAATCAATAGTATCCATATTTGTAAGATATCTTACGATTTCAATAAAGTTGATTTCAGGTAAAGAATATTGCCAAAGTGTTCCTTT

Reverse complement sequence

AAAGGAACACTTTGGCAATATTCTTTACCTGAAATCAACTTTATTGAAATCGTAAGATATCTTACAAATATGGATACTATTGATTTATACATAAAATTTA[C/T]
GTAATTGATCAATGTTCCAAGAATTTGCTAACTTGCGGCCATCGCCGTCTGCAATCTTGAATGCGCCCGGCCGCAAGACTTGCGTGATCGTGTATGGTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	27.00%	0.40%	0.97%	NA
All Indica	2759	67.10%	30.70%	0.54%	1.67%	NA
All Japonica	1512	74.10%	25.70%	0.20%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	97.30%	2.50%	0.00%	0.17%	NA
Indica II	465	61.10%	35.90%	0.65%	2.37%	NA
Indica III	913	52.10%	45.00%	0.44%	2.41%	NA
Indica Intermediate	786	65.00%	32.40%	1.02%	1.53%	NA
Temperate Japonica	767	97.00%	2.70%	0.26%	0.00%	NA
Tropical Japonica	504	54.40%	45.60%	0.00%	0.00%	NA
Japonica Intermediate	241	42.70%	56.80%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	64.40%	34.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122407829	G -> A	LOC_Os01g39750.1	upstream_gene_variant ; 4649.0bp to feature; MODIFIER	silent_mutation	Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0122407829	G -> A	LOC_Os01g39720.1	downstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0122407829	G -> A	LOC_Os01g39730.1	downstream_gene_variant ; 608.0bp to feature; MODIFIER	silent_mutation	Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0122407829	G -> A	LOC_Os01g39740.1	downstream_gene_variant ; 528.0bp to feature; MODIFIER	silent_mutation	Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0122407829	G -> A	LOC_Os01g39730-LOC_Os01g39740	intergenic_region ; MODIFIER	silent_mutation	Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0122407829	G -> DEL	N	N	silent_mutation	Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122407829	NA	1.99E-06	mr1318	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	1.38E-09	mr1380	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	5.01E-06	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	2.64E-06	1.14E-10	mr1561	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	1.59E-07	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	3.66E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	2.51E-06	1.38E-08	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	4.93E-07	4.93E-07	mr1875	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	3.11E-06	6.16E-09	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	2.77E-06	1.23E-07	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	1.23E-07	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	4.70E-07	4.69E-07	mr1996	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	3.20E-09	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	9.74E-08	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	2.93E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	1.09E-08	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	4.86E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	4.00E-07	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	1.02E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829	NA	7.55E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251