\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122407829:

Variant ID: vg0122407829 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22407829
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


GGACCATACACGATCACGCAAGTCTTGCGGCCGGGCGCATTCAAGATTGCAGACGGCGATGGCCGCAAGTTAGCAAATTCTTGGAACATTGATCAATTAC[G/A]
TAAATTTTATGTATAAATCAATAGTATCCATATTTGTAAGATATCTTACGATTTCAATAAAGTTGATTTCAGGTAAAGAATATTGCCAAAGTGTTCCTTT

Reverse complement sequence

AAAGGAACACTTTGGCAATATTCTTTACCTGAAATCAACTTTATTGAAATCGTAAGATATCTTACAAATATGGATACTATTGATTTATACATAAAATTTA[C/T]
GTAATTGATCAATGTTCCAAGAATTTGCTAACTTGCGGCCATCGCCGTCTGCAATCTTGAATGCGCCCGGCCGCAAGACTTGCGTGATCGTGTATGGTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 27.00% 0.40% 0.97% NA
All Indica  2759 67.10% 30.70% 0.54% 1.67% NA
All Japonica  1512 74.10% 25.70% 0.20% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 97.30% 2.50% 0.00% 0.17% NA
Indica II  465 61.10% 35.90% 0.65% 2.37% NA
Indica III  913 52.10% 45.00% 0.44% 2.41% NA
Indica Intermediate  786 65.00% 32.40% 1.02% 1.53% NA
Temperate Japonica  767 97.00% 2.70% 0.26% 0.00% NA
Tropical Japonica  504 54.40% 45.60% 0.00% 0.00% NA
Japonica Intermediate  241 42.70% 56.80% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122407829 G -> A LOC_Os01g39750.1 upstream_gene_variant ; 4649.0bp to feature; MODIFIER silent_mutation Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0122407829 G -> A LOC_Os01g39720.1 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0122407829 G -> A LOC_Os01g39730.1 downstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0122407829 G -> A LOC_Os01g39740.1 downstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0122407829 G -> A LOC_Os01g39730-LOC_Os01g39740 intergenic_region ; MODIFIER silent_mutation Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0122407829 G -> DEL N N silent_mutation Average:40.923; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122407829 NA 1.99E-06 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 1.38E-09 mr1380 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 5.01E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 2.64E-06 1.14E-10 mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 1.59E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 3.66E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 2.51E-06 1.38E-08 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 4.93E-07 4.93E-07 mr1875 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 3.11E-06 6.16E-09 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 2.77E-06 1.23E-07 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 1.23E-07 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 4.70E-07 4.69E-07 mr1996 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 3.20E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 9.74E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 2.93E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 1.09E-08 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 4.86E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 4.00E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 1.02E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407829 NA 7.55E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251