\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122407241:

Variant ID: vg0122407241 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22407241
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGGAATATTCTGCAGATATGGATTGTCTCACCGCATCATAACAGACAACGGCTCCCAGTTCATCAGTGCCGACTTCTAGGATTACAGCATTGGATTGG[G/A]
AGTCAAGATTTGCTTCGCCTCGGTTTCTCACCCTCAGAGCAATGGACAAGTCGAAAGGGCAAACGGCATAGTGCTACAAGGGATCAAGACCCGCGTCTAT

Reverse complement sequence

ATAGACGCGGGTCTTGATCCCTTGTAGCACTATGCCGTTTGCCCTTTCGACTTGTCCATTGCTCTGAGGGTGAGAAACCGAGGCGAAGCAAATCTTGACT[C/T]
CCAATCCAATGCTGTAATCCTAGAAGTCGGCACTGATGAACTGGGAGCCGTTGTCTGTTATGATGCGGTGAGACAATCCATATCTGCAGAATATTCCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 8.00% 0.00% 0.00% NA
All Indica  2759 86.70% 13.30% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 74.60% 25.40% 0.00% 0.00% NA
Indica Intermediate  786 85.90% 14.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122407241 G -> A LOC_Os01g39720.1 downstream_gene_variant ; 2587.0bp to feature; MODIFIER silent_mutation Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0122407241 G -> A LOC_Os01g39730.1 downstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0122407241 G -> A LOC_Os01g39740.1 downstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0122407241 G -> A LOC_Os01g39730-LOC_Os01g39740 intergenic_region ; MODIFIER silent_mutation Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122407241 9.02E-06 3.57E-07 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 1.95E-07 2.45E-11 mr1561 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 5.65E-06 5.65E-06 mr1875 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 1.08E-06 4.61E-08 mr1908 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 NA 2.46E-06 mr1937 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 3.52E-06 3.52E-06 mr1996 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 NA 9.71E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 NA 5.42E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 NA 8.02E-08 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 NA 5.51E-10 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241 NA 1.46E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251