\
| Variant ID: vg0122407241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22407241 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )
AAAGGAATATTCTGCAGATATGGATTGTCTCACCGCATCATAACAGACAACGGCTCCCAGTTCATCAGTGCCGACTTCTAGGATTACAGCATTGGATTGG[G/A]
AGTCAAGATTTGCTTCGCCTCGGTTTCTCACCCTCAGAGCAATGGACAAGTCGAAAGGGCAAACGGCATAGTGCTACAAGGGATCAAGACCCGCGTCTAT
ATAGACGCGGGTCTTGATCCCTTGTAGCACTATGCCGTTTGCCCTTTCGACTTGTCCATTGCTCTGAGGGTGAGAAACCGAGGCGAAGCAAATCTTGACT[C/T]
CCAATCCAATGCTGTAATCCTAGAAGTCGGCACTGATGAACTGGGAGCCGTTGTCTGTTATGATGCGGTGAGACAATCCATATCTGCAGAATATTCCTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.60% | 25.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122407241 | G -> A | LOC_Os01g39720.1 | downstream_gene_variant ; 2587.0bp to feature; MODIFIER | silent_mutation | Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg0122407241 | G -> A | LOC_Os01g39730.1 | downstream_gene_variant ; 20.0bp to feature; MODIFIER | silent_mutation | Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg0122407241 | G -> A | LOC_Os01g39740.1 | downstream_gene_variant ; 1116.0bp to feature; MODIFIER | silent_mutation | Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg0122407241 | G -> A | LOC_Os01g39730-LOC_Os01g39740 | intergenic_region ; MODIFIER | silent_mutation | Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122407241 | 9.02E-06 | 3.57E-07 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | 1.95E-07 | 2.45E-11 | mr1561 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | 5.65E-06 | 5.65E-06 | mr1875 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | 1.08E-06 | 4.61E-08 | mr1908 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | NA | 2.46E-06 | mr1937 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | 3.52E-06 | 3.52E-06 | mr1996 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | NA | 9.71E-09 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | NA | 5.42E-10 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | NA | 8.02E-08 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | NA | 5.51E-10 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122407241 | NA | 1.46E-08 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |