Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122407241:

Variant ID: vg0122407241 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22407241
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGGAATATTCTGCAGATATGGATTGTCTCACCGCATCATAACAGACAACGGCTCCCAGTTCATCAGTGCCGACTTCTAGGATTACAGCATTGGATTGG[G/A]
AGTCAAGATTTGCTTCGCCTCGGTTTCTCACCCTCAGAGCAATGGACAAGTCGAAAGGGCAAACGGCATAGTGCTACAAGGGATCAAGACCCGCGTCTAT

Reverse complement sequence

ATAGACGCGGGTCTTGATCCCTTGTAGCACTATGCCGTTTGCCCTTTCGACTTGTCCATTGCTCTGAGGGTGAGAAACCGAGGCGAAGCAAATCTTGACT[C/T]
CCAATCCAATGCTGTAATCCTAGAAGTCGGCACTGATGAACTGGGAGCCGTTGTCTGTTATGATGCGGTGAGACAATCCATATCTGCAGAATATTCCTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	8.00%	0.00%	0.00%	NA
All Indica	2759	86.70%	13.30%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	74.60%	25.40%	0.00%	0.00%	NA
Indica Intermediate	786	85.90%	14.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122407241	G -> A	LOC_Os01g39720.1	downstream_gene_variant ; 2587.0bp to feature; MODIFIER	silent_mutation	Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0122407241	G -> A	LOC_Os01g39730.1	downstream_gene_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0122407241	G -> A	LOC_Os01g39740.1	downstream_gene_variant ; 1116.0bp to feature; MODIFIER	silent_mutation	Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0122407241	G -> A	LOC_Os01g39730-LOC_Os01g39740	intergenic_region ; MODIFIER	silent_mutation	Average:43.79; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122407241	9.02E-06	3.57E-07	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	1.95E-07	2.45E-11	mr1561	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	5.65E-06	5.65E-06	mr1875	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	1.08E-06	4.61E-08	mr1908	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	NA	2.46E-06	mr1937	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	3.52E-06	3.52E-06	mr1996	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	NA	9.71E-09	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	NA	5.42E-10	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	NA	8.02E-08	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	NA	5.51E-10	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122407241	NA	1.46E-08	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251