Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122403766:

Variant ID: vg0122403766 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22403766
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

ACCCGCCCAAGAACCCAGACCCACAAGGCGACGATACGAATAAAATATGGTGCCTTATACACAAGACGGACAAGCACTCTCTGGAGACTTGTTTCATCTT[C/T]
GAAAAGGCACTCACAAAGAAACTAGCGTTGGAGAGGGGCAAGCGAGTACATGTAGTCGAGAAGGCCGCAGAAGCGACTACTTAGGTCTCAGATTCAGCTT

Reverse complement sequence

AAGCTGAATCTGAGACCTAAGTAGTCGCTTCTGCGGCCTTCTCGACTACATGTACTCGCTTGCCCCTCTCCAACGCTAGTTTCTTTGTGAGTGCCTTTTC[G/A]
AAGATGAAACAAGTCTCCAGAGAGTGCTTGTCCGTCTTGTGTATAAGGCACCATATTTTATTCGTATCGTCGCCTTGTGGGTCTGGGTTCTTGGGCGGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.50%	19.20%	0.02%	0.28%	NA
All Indica	2759	67.50%	32.10%	0.04%	0.40%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	97.30%	2.70%	0.00%	0.00%	NA
Indica II	465	61.50%	37.40%	0.22%	0.86%	NA
Indica III	913	52.50%	47.40%	0.00%	0.11%	NA
Indica Intermediate	786	65.90%	33.30%	0.00%	0.76%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	82.20%	15.60%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122403766	C -> T	LOC_Os01g39730.1	upstream_gene_variant ; 1171.0bp to feature; MODIFIER	silent_mutation	Average:49.865; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N
vg0122403766	C -> T	LOC_Os01g39740.1	downstream_gene_variant ; 4591.0bp to feature; MODIFIER	silent_mutation	Average:49.865; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N
vg0122403766	C -> T	LOC_Os01g39720.1	intron_variant ; MODIFIER	silent_mutation	Average:49.865; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N
vg0122403766	C -> DEL	N	N	silent_mutation	Average:49.865; most accessible tissue: Zhenshan97 young leaf, score: 66.83	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122403766	NA	6.90E-08	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	3.32E-07	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	1.46E-06	5.44E-12	mr1561	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	3.65E-07	5.14E-11	mr1561	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	1.12E-07	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	1.07E-06	1.07E-06	mr1875	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	5.51E-09	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	2.27E-06	7.29E-08	mr1908	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	5.47E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	3.39E-06	3.39E-06	mr1996	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	3.13E-06	3.13E-06	mr1996	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	2.76E-10	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	3.10E-09	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	4.22E-12	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	1.55E-10	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	6.41E-10	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	4.66E-08	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	9.65E-12	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	4.63E-10	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	1.35E-09	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122403766	NA	1.10E-08	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251