Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122381459:

Variant ID: vg0122381459 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22381459
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CCATCACAAGTATACAACTGGATTTGCACAATGTTACTTGAAATGCCATTGACTTCATCAGGGAATACTATTCTGAAATGGTTAATAGGAACCTTGCATG[T/C]
AAAAACTTCTCCATCCATTTGTTAGCACTTAGCATAAGTCTACATTATTAGGAAGTATGATTTCACAATGTAAGTCAACAAAAGAATTCAAGAACATCAT

Reverse complement sequence

ATGATGTTCTTGAATTCTTTTGTTGACTTACATTGTGAAATCATACTTCCTAATAATGTAGACTTATGCTAAGTGCTAACAAATGGATGGAGAAGTTTTT[A/G]
CATGCAAGGTTCCTATTAACCATTTCAGAATAGTATTCCCTGATGAAGTCAATGGCATTTCAAGTAACATTGTGCAAATCCAGTTGTATACTTGTGATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	10.90%	0.08%	0.00%	NA
All Indica	2759	81.70%	18.20%	0.14%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	96.10%	3.20%	0.67%	0.00%	NA
Indica II	465	93.80%	6.20%	0.00%	0.00%	NA
Indica III	913	65.90%	34.10%	0.00%	0.00%	NA
Indica Intermediate	786	81.80%	18.20%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122381459	T -> C	LOC_Os01g39690.1	upstream_gene_variant ; 3733.0bp to feature; MODIFIER	silent_mutation	Average:46.764; most accessible tissue: Callus, score: 74.514	N	N	N	N
vg0122381459	T -> C	LOC_Os01g39670.1	downstream_gene_variant ; 3899.0bp to feature; MODIFIER	silent_mutation	Average:46.764; most accessible tissue: Callus, score: 74.514	N	N	N	N
vg0122381459	T -> C	LOC_Os01g39680.1	intron_variant ; MODIFIER	silent_mutation	Average:46.764; most accessible tissue: Callus, score: 74.514	N	N	N	N
vg0122381459	T -> C	LOC_Os01g39680.2	intron_variant ; MODIFIER	silent_mutation	Average:46.764; most accessible tissue: Callus, score: 74.514	N	N	N	N
vg0122381459	T -> C	LOC_Os01g39680.3	intron_variant ; MODIFIER	silent_mutation	Average:46.764; most accessible tissue: Callus, score: 74.514	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122381459	NA	7.96E-09	mr1380	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	5.89E-07	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	4.93E-06	8.91E-12	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	3.70E-06	2.78E-09	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	2.82E-08	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	5.73E-06	5.73E-06	mr1875	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	2.63E-09	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	1.08E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	2.46E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	2.03E-06	2.03E-06	mr1996	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	2.76E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	8.17E-09	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	2.96E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	1.34E-07	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	2.98E-09	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	3.29E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122381459	NA	1.65E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251