\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122379413:

Variant ID: vg0122379413 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22379413
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, A: 0.36, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CGACCAGGGGGACGCGCGCGCCTCGGACACGGTCGCCCCCTCGCCGCCCTCACCGTGTGAATCCCAGGAGCAACCCCACCATCTTGGCAAGGTTTTGAGT[A/C]
CTCATCCTCTCATCCACGTCCTTTTCCAAGCTCAAACCCCCCACCCTTTTTAATTTGTTCGTTCGTGCCCGCAGAGGCTGGAGGATGTGCTTATTTCCCT

Reverse complement sequence

AGGGAAATAAGCACATCCTCCAGCCTCTGCGGGCACGAACGAACAAATTAAAAAGGGTGGGGGGTTTGAGCTTGGAAAAGGACGTGGATGAGAGGATGAG[T/G]
ACTCAAAACCTTGCCAAGATGGTGGGGTTGCTCCTGGGATTCACACGGTGAGGGCGGCGAGGGGGCGACCGTGTCCGAGGCGCGCGCGTCCCCCTGGTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 36.00% 0.36% 10.26% NA
All Indica  2759 75.20% 7.10% 0.62% 17.11% NA
All Japonica  1512 5.10% 94.90% 0.00% 0.00% NA
Aus  269 88.80% 9.70% 0.00% 1.49% NA
Indica I  595 97.10% 0.30% 0.17% 2.35% NA
Indica II  465 92.30% 2.20% 0.00% 5.59% NA
Indica III  913 53.10% 13.80% 1.20% 31.87% NA
Indica Intermediate  786 74.20% 7.30% 0.64% 17.94% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 13.30% 86.70% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 3.10% 0.00% 3.12% NA
Intermediate  90 48.90% 44.40% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122379413 A -> DEL N N silent_mutation Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg0122379413 A -> C LOC_Os01g39670.1 downstream_gene_variant ; 1853.0bp to feature; MODIFIER silent_mutation Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg0122379413 A -> C LOC_Os01g39680.1 intron_variant ; MODIFIER silent_mutation Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg0122379413 A -> C LOC_Os01g39680.2 intron_variant ; MODIFIER silent_mutation Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg0122379413 A -> C LOC_Os01g39680.3 intron_variant ; MODIFIER silent_mutation Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122379413 5.66E-06 5.33E-08 mr1380 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 NA 9.02E-09 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 NA 6.59E-09 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 NA 4.37E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 7.90E-06 7.90E-06 mr1875 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 NA 1.75E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 NA 3.54E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 NA 9.53E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 NA 7.42E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122379413 NA 6.78E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251