\
| Variant ID: vg0122379413 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22379413 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, A: 0.36, others allele: 0.00, population size: 101. )
CGACCAGGGGGACGCGCGCGCCTCGGACACGGTCGCCCCCTCGCCGCCCTCACCGTGTGAATCCCAGGAGCAACCCCACCATCTTGGCAAGGTTTTGAGT[A/C]
CTCATCCTCTCATCCACGTCCTTTTCCAAGCTCAAACCCCCCACCCTTTTTAATTTGTTCGTTCGTGCCCGCAGAGGCTGGAGGATGTGCTTATTTCCCT
AGGGAAATAAGCACATCCTCCAGCCTCTGCGGGCACGAACGAACAAATTAAAAAGGGTGGGGGGTTTGAGCTTGGAAAAGGACGTGGATGAGAGGATGAG[T/G]
ACTCAAAACCTTGCCAAGATGGTGGGGTTGCTCCTGGGATTCACACGGTGAGGGCGGCGAGGGGGCGACCGTGTCCGAGGCGCGCGCGTCCCCCTGGTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 36.00% | 0.36% | 10.26% | NA |
| All Indica | 2759 | 75.20% | 7.10% | 0.62% | 17.11% | NA |
| All Japonica | 1512 | 5.10% | 94.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.80% | 9.70% | 0.00% | 1.49% | NA |
| Indica I | 595 | 97.10% | 0.30% | 0.17% | 2.35% | NA |
| Indica II | 465 | 92.30% | 2.20% | 0.00% | 5.59% | NA |
| Indica III | 913 | 53.10% | 13.80% | 1.20% | 31.87% | NA |
| Indica Intermediate | 786 | 74.20% | 7.30% | 0.64% | 17.94% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 3.10% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 48.90% | 44.40% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122379413 | A -> DEL | N | N | silent_mutation | Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | N | N | N | N |
| vg0122379413 | A -> C | LOC_Os01g39670.1 | downstream_gene_variant ; 1853.0bp to feature; MODIFIER | silent_mutation | Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | N | N | N | N |
| vg0122379413 | A -> C | LOC_Os01g39680.1 | intron_variant ; MODIFIER | silent_mutation | Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | N | N | N | N |
| vg0122379413 | A -> C | LOC_Os01g39680.2 | intron_variant ; MODIFIER | silent_mutation | Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | N | N | N | N |
| vg0122379413 | A -> C | LOC_Os01g39680.3 | intron_variant ; MODIFIER | silent_mutation | Average:68.08; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122379413 | 5.66E-06 | 5.33E-08 | mr1380 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | NA | 9.02E-09 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | NA | 6.59E-09 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | NA | 4.37E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | 7.90E-06 | 7.90E-06 | mr1875 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | NA | 1.75E-06 | mr1908 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | NA | 3.54E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | NA | 9.53E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | NA | 7.42E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122379413 | NA | 6.78E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |