\
| Variant ID: vg0122345272 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22345272 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, T: 0.22, others allele: 0.00, population size: 104. )
TGGTGGGTCCTGCCGAGATTTAGGCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGATACTATTTATATTTAAACTACGATTGCTCTTTTTTT[A/T]
AAATAAAAAATAAAATCCTTAAAAGGATATGTTGCATCCTAAACATAATCATTAAGATTTAGTATATTGATCATACCTTAATCATTTAAAAATTATTAAT
ATTAATAATTTTTAAATGATTAAGGTATGATCAATATACTAAATCTTAATGATTATGTTTAGGATGCAACATATCCTTTTAAGGATTTTATTTTTTATTT[T/A]
AAAAAAAGAGCAATCGTAGTTTAAATATAAATAGTATCTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGCCTAAATCTCGGCAGGACCCACCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 45.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 81.60% | 18.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.20% | 33.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.70% | 30.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 76.30% | 23.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 48.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122345272 | A -> T | LOC_Os01g39600.1 | upstream_gene_variant ; 3794.0bp to feature; MODIFIER | silent_mutation | Average:40.269; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0122345272 | A -> T | LOC_Os01g39600.2 | upstream_gene_variant ; 3727.0bp to feature; MODIFIER | silent_mutation | Average:40.269; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0122345272 | A -> T | LOC_Os01g39600-LOC_Os01g39630 | intergenic_region ; MODIFIER | silent_mutation | Average:40.269; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122345272 | NA | 1.14E-34 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122345272 | NA | 8.96E-09 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122345272 | NA | 2.58E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122345272 | 3.36E-06 | 2.61E-06 | mr1509_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |