\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122331148:

Variant ID: vg0122331148 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22331148
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.04, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAATCTGATATGAACTATTGTTTGAATTCTGTTGTATTCTGGTTGTATCTATTATTAGTTGAATCTGAGATGGTATATGTTATTAGGTTTTAATCTGA[T/G]
ATGTATGAGAAATTGGATTGAATTTGGTGGGCTCAAATTTAATTGGCCTGTTTAGTGGGCTTTGACTTGTAGTTGGTTGACAAAATGGGCCTAGTTCTGA

Reverse complement sequence

TCAGAACTAGGCCCATTTTGTCAACCAACTACAAGTCAAAGCCCACTAAACAGGCCAATTAAATTTGAGCCCACCAAATTCAATCCAATTTCTCATACAT[A/C]
TCAGATTAAAACCTAATAACATATACCATCTCAGATTCAACTAATAATAGATACAACCAGAATACAACAGAATTCAAACAATAGTTCATATCAGATTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 40.10% 0.30% 13.35% NA
All Indica  2759 69.00% 11.50% 0.36% 19.17% NA
All Japonica  1512 3.40% 96.40% 0.00% 0.20% NA
Aus  269 70.30% 27.50% 0.00% 2.23% NA
Indica I  595 97.00% 0.30% 0.00% 2.69% NA
Indica II  465 89.90% 5.40% 0.22% 4.52% NA
Indica III  913 41.90% 19.70% 0.55% 37.79% NA
Indica Intermediate  786 66.90% 13.90% 0.51% 18.70% NA
Temperate Japonica  767 4.80% 95.20% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 93.80% 0.00% 1.24% NA
VI/Aromatic  96 9.40% 5.20% 3.12% 82.29% NA
Intermediate  90 35.60% 47.80% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122331148 T -> G LOC_Os01g39580.1 downstream_gene_variant ; 3777.0bp to feature; MODIFIER silent_mutation Average:90.605; most accessible tissue: Minghui63 young leaf, score: 95.898 N N N N
vg0122331148 T -> G LOC_Os01g39590.1 downstream_gene_variant ; 1379.0bp to feature; MODIFIER silent_mutation Average:90.605; most accessible tissue: Minghui63 young leaf, score: 95.898 N N N N
vg0122331148 T -> G LOC_Os01g39580-LOC_Os01g39590 intergenic_region ; MODIFIER silent_mutation Average:90.605; most accessible tissue: Minghui63 young leaf, score: 95.898 N N N N
vg0122331148 T -> DEL N N silent_mutation Average:90.605; most accessible tissue: Minghui63 young leaf, score: 95.898 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122331148 T G 0.0 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122331148 NA 3.56E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122331148 NA 7.82E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122331148 NA 1.45E-25 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122331148 1.91E-07 NA mr1509_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122331148 NA 4.91E-06 mr1509_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122331148 NA 5.64E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122331148 NA 4.79E-24 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122331148 NA 1.36E-06 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251