\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122328226:

Variant ID: vg0122328226 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22328226
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ACACCTCCTTTATTTTACAAACAGATTAAAAAGAGACTAGCGGTGGGAGCGTCGGCGACAGGCACGGCTACAACGCACCTCGGCTCCTCCACCCAGATGG[C/T]
CTCAAGATGGTCGAATCTAGTGGTCCTGGGATGACGACCCTAACTTCTAGTAGCGGTGATGGGGGCGACCGCCATGCACCTTGGCTCCTCCACCCAGGTA

Reverse complement sequence

TACCTGGGTGGAGGAGCCAAGGTGCATGGCGGTCGCCCCCATCACCGCTACTAGAAGTTAGGGTCGTCATCCCAGGACCACTAGATTCGACCATCTTGAG[G/A]
CCATCTGGGTGGAGGAGCCGAGGTGCGTTGTAGCCGTGCCTGTCGCCGACGCTCCCACCGCTAGTCTCTTTTTAATCTGTTTGTAAAATAAAGGAGGTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 26.30% 0.91% 12.57% NA
All Indica  2759 36.10% 44.60% 1.56% 17.76% NA
All Japonica  1512 99.60% 0.20% 0.00% 0.20% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 3.40% 93.90% 0.00% 2.69% NA
Indica II  465 32.50% 62.80% 3.44% 1.29% NA
Indica III  913 50.80% 10.80% 2.08% 36.25% NA
Indica Intermediate  786 45.90% 35.60% 1.02% 17.43% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 15.60% 0.00% 0.00% 84.38% NA
Intermediate  90 72.20% 12.20% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122328226 C -> T LOC_Os01g39580.1 downstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:68.866; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N
vg0122328226 C -> T LOC_Os01g39590.1 downstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:68.866; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N
vg0122328226 C -> T LOC_Os01g39580-LOC_Os01g39590 intergenic_region ; MODIFIER silent_mutation Average:68.866; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N
vg0122328226 C -> DEL N N silent_mutation Average:68.866; most accessible tissue: Zhenshan97 young leaf, score: 85.715 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122328226 NA 6.11E-43 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 7.20E-10 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 9.17E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 2.36E-08 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 4.33E-07 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 5.43E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 2.98E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 1.43E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 9.02E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 1.53E-09 mr1613 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 1.82E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 7.08E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 8.26E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 8.05E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 3.07E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 3.68E-12 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 3.18E-11 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 4.53E-10 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 2.31E-09 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 1.73E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 2.46E-07 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 1.24E-10 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 5.23E-10 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226 NA 3.63E-11 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251