Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122328226:

Variant ID: vg0122328226 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22328226
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

ACACCTCCTTTATTTTACAAACAGATTAAAAAGAGACTAGCGGTGGGAGCGTCGGCGACAGGCACGGCTACAACGCACCTCGGCTCCTCCACCCAGATGG[C/T]
CTCAAGATGGTCGAATCTAGTGGTCCTGGGATGACGACCCTAACTTCTAGTAGCGGTGATGGGGGCGACCGCCATGCACCTTGGCTCCTCCACCCAGGTA

Reverse complement sequence

TACCTGGGTGGAGGAGCCAAGGTGCATGGCGGTCGCCCCCATCACCGCTACTAGAAGTTAGGGTCGTCATCCCAGGACCACTAGATTCGACCATCTTGAG[G/A]
CCATCTGGGTGGAGGAGCCGAGGTGCGTTGTAGCCGTGCCTGTCGCCGACGCTCCCACCGCTAGTCTCTTTTTAATCTGTTTGTAAAATAAAGGAGGTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.20%	26.30%	0.91%	12.57%	NA
All Indica	2759	36.10%	44.60%	1.56%	17.76%	NA
All Japonica	1512	99.60%	0.20%	0.00%	0.20%	NA
Aus	269	97.80%	0.00%	0.00%	2.23%	NA
Indica I	595	3.40%	93.90%	0.00%	2.69%	NA
Indica II	465	32.50%	62.80%	3.44%	1.29%	NA
Indica III	913	50.80%	10.80%	2.08%	36.25%	NA
Indica Intermediate	786	45.90%	35.60%	1.02%	17.43%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	15.60%	0.00%	0.00%	84.38%	NA
Intermediate	90	72.20%	12.20%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122328226	C -> T	LOC_Os01g39580.1	downstream_gene_variant ; 855.0bp to feature; MODIFIER	silent_mutation	Average:68.866; most accessible tissue: Zhenshan97 young leaf, score: 85.715	N	N	N	N
vg0122328226	C -> T	LOC_Os01g39590.1	downstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:68.866; most accessible tissue: Zhenshan97 young leaf, score: 85.715	N	N	N	N
vg0122328226	C -> T	LOC_Os01g39580-LOC_Os01g39590	intergenic_region ; MODIFIER	silent_mutation	Average:68.866; most accessible tissue: Zhenshan97 young leaf, score: 85.715	N	N	N	N
vg0122328226	C -> DEL	N	N	silent_mutation	Average:68.866; most accessible tissue: Zhenshan97 young leaf, score: 85.715	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122328226	NA	6.11E-43	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	7.20E-10	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	9.17E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	2.36E-08	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	4.33E-07	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	5.43E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	2.98E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	1.43E-09	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	9.02E-06	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	1.53E-09	mr1613	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	1.82E-06	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	7.08E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	8.26E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	8.05E-06	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	3.07E-11	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	3.68E-12	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	3.18E-11	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	4.53E-10	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	2.31E-09	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	1.73E-08	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	2.46E-07	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	1.24E-10	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	5.23E-10	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122328226	NA	3.63E-11	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251