\
| Variant ID: vg0122291977 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22291977 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCCCTCTCCAACGCTACTCTCTCCCTCTCCGGCGTCTCACCCTCTTCCTCTCCCTCTCTAGCTCCTCTCCCTCTGGGTACCACACGCTCCCTCTCCATC[C/T]
GGCGCCGCTCACTCTTCCTCTCCGACGCGCTCTAGTGACGAGGGAGAGGAGCTGGCGGCCAGTCCTAGGTGACCCCGATCTCGGCGAAGGCAGGTGGCTC
GAGCCACCTGCCTTCGCCGAGATCGGGGTCACCTAGGACTGGCCGCCAGCTCCTCTCCCTCGTCACTAGAGCGCGTCGGAGAGGAAGAGTGAGCGGCGCC[G/A]
GATGGAGAGGGAGCGTGTGGTACCCAGAGGGAGAGGAGCTAGAGAGGGAGAGGAAGAGGGTGAGACGCCGGAGAGGGAGAGAGTAGCGTTGGAGAGGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 12.10% | 0.11% | 2.14% | NA |
| All Indica | 2759 | 80.80% | 17.10% | 0.04% | 1.99% | NA |
| All Japonica | 1512 | 97.20% | 0.20% | 0.20% | 2.45% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.00% | 0.17% | 0.50% | NA |
| Indica II | 465 | 97.40% | 1.10% | 0.00% | 1.51% | NA |
| Indica III | 913 | 61.10% | 35.70% | 0.00% | 3.18% | NA |
| Indica Intermediate | 786 | 81.40% | 16.50% | 0.00% | 2.04% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.39% | 3.65% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 1.20% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 13.50% | 78.10% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122291977 | C -> T | LOC_Os01g39550.1 | upstream_gene_variant ; 3756.0bp to feature; MODIFIER | silent_mutation | Average:75.806; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| vg0122291977 | C -> T | LOC_Os01g39540-LOC_Os01g39550 | intergenic_region ; MODIFIER | silent_mutation | Average:75.806; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| vg0122291977 | C -> DEL | N | N | silent_mutation | Average:75.806; most accessible tissue: Zhenshan97 young leaf, score: 90.456 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122291977 | NA | 1.57E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122291977 | NA | 1.91E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122291977 | NA | 1.58E-06 | mr1994_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |