Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122261348:

Variant ID: vg0122261348 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22261348
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CTATATATTTGTCATCAAATTTTCTCTTGAAATTTTGTCAAATATAATTACCTTATATTATAAGTATAATTACATTGTAACTTTCATATAATTTTGAATC[A/G]
TTAGATTTGCTTCAAAATTCATGCAAGAGGTGAAGAAAAAAAAATCACAGTGCGAACATGGGTGATGTGATTTTGTCGAGTGGCATCCACTTTACGAGTA

Reverse complement sequence

TACTCGTAAAGTGGATGCCACTCGACAAAATCACATCACCCATGTTCGCACTGTGATTTTTTTTTCTTCACCTCTTGCATGAATTTTGAAGCAAATCTAA[T/C]
GATTCAAAATTATATGAAAGTTACAATGTAATTATACTTATAATATAAGGTAATTATATTTGACAAAATTTCAAGAGAAAATTTGATGACAAATATATAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	40.40%	0.06%	0.68%	NA
All Indica	2759	88.70%	11.30%	0.00%	0.00%	NA
All Japonica	1512	0.50%	97.40%	0.07%	1.98%	NA
Aus	269	71.00%	28.30%	0.00%	0.74%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	80.90%	19.10%	0.00%	0.00%	NA
Indica Intermediate	786	85.90%	14.10%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	96.90%	0.13%	2.74%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	94.60%	0.00%	3.73%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	48.90%	50.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122261348	A -> G	LOC_Os01g39490.1	upstream_gene_variant ; 3589.0bp to feature; MODIFIER	silent_mutation	Average:51.195; most accessible tissue: Minghui63 flower, score: 69.223	N	N	N	N
vg0122261348	A -> G	LOC_Os01g39500.1	upstream_gene_variant ; 2779.0bp to feature; MODIFIER	silent_mutation	Average:51.195; most accessible tissue: Minghui63 flower, score: 69.223	N	N	N	N
vg0122261348	A -> G	LOC_Os01g39490-LOC_Os01g39500	intergenic_region ; MODIFIER	silent_mutation	Average:51.195; most accessible tissue: Minghui63 flower, score: 69.223	N	N	N	N
vg0122261348	A -> DEL	N	N	silent_mutation	Average:51.195; most accessible tissue: Minghui63 flower, score: 69.223	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122261348	NA	1.74E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	4.36E-06	5.46E-78	mr1613	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	8.42E-06	6.43E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	4.05E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	2.23E-20	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	6.96E-12	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	9.54E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	2.78E-08	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	5.15E-06	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	6.06E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	8.76E-12	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	4.12E-08	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	3.57E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	4.75E-06	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122261348	NA	1.48E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251