\
| Variant ID: vg0122207812 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22207812 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, A: 0.15, others allele: 0.00, population size: 86. )
GCTCATGTACGGTGGGACACGGGCTCACGGATGGAGTCTTGGACCTCGGGGACGGCGGGGAACAACGGTGCTGGTTGTGCTTAATTGGAGAAGCTCAAGG[A/C]
GGCGGCGCCGGTGAGGAGCTCACGGGCGGCAGCGACGGGCTCGCGAACGACGGCGAGGAGCTCGAGGACGGCGCCGGGATCGGGGGAGGTGTTCGATGCG
CGCATCGAACACCTCCCCCGATCCCGGCGCCGTCCTCGAGCTCCTCGCCGTCGTTCGCGAGCCCGTCGCTGCCGCCCGTGAGCTCCTCACCGGCGCCGCC[T/G]
CCTTGAGCTTCTCCAATTAAGCACAACCAGCACCGTTGTTCCCCGCCGTCCCCGAGGTCCAAGACTCCATCCGTGAGCCCGTGTCCCACCGTACATGAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.80% | 44.30% | 0.15% | 0.72% | NA |
| All Indica | 2759 | 86.80% | 13.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 0.40% | 97.30% | 0.07% | 2.25% | NA |
| Aus | 269 | 55.00% | 44.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.10% | 16.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 96.60% | 0.13% | 3.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 94.60% | 0.00% | 4.56% | NA |
| VI/Aromatic | 96 | 9.40% | 89.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 62.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122207812 | A -> DEL | N | N | silent_mutation | Average:73.831; most accessible tissue: Minghui63 flag leaf, score: 82.75 | N | N | N | N |
| vg0122207812 | A -> C | LOC_Os01g39420.1 | downstream_gene_variant ; 3007.0bp to feature; MODIFIER | silent_mutation | Average:73.831; most accessible tissue: Minghui63 flag leaf, score: 82.75 | N | N | N | N |
| vg0122207812 | A -> C | LOC_Os01g39399.1 | intron_variant ; MODIFIER | silent_mutation | Average:73.831; most accessible tissue: Minghui63 flag leaf, score: 82.75 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122207812 | NA | 1.50E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | NA | 1.06E-21 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | 2.52E-06 | 2.52E-06 | mr1065 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | 2.16E-06 | 2.50E-06 | mr1078 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | NA | 3.57E-06 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | NA | 1.20E-06 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | NA | 1.17E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | NA | 1.56E-08 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | 7.66E-06 | 3.80E-06 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | NA | 2.58E-25 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122207812 | NA | 1.64E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |