\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122205444:

Variant ID: vg0122205444 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22205444
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTACCAACCAGGACTAAAAGTCTATCTTTAGTCCCTGTTGGAGTTATCATCCGGGAATAAATATTTCTCTCCCACATCTGATCGTTAAGTCCCAGACA[G/T]
ATATTTAGATAAGATTGGATCGTCTTTTCTCTTCCTCCTCTTAGATCCAATCATCTCTCTTCCTCTTCTCGGATCCAATCCCCTTCCTTCTCCCCTCCCC

Reverse complement sequence

GGGGAGGGGAGAAGGAAGGGGATTGGATCCGAGAAGAGGAAGAGAGATGATTGGATCTAAGAGGAGGAAGAGAAAAGACGATCCAATCTTATCTAAATAT[C/A]
TGTCTGGGACTTAACGATCAGATGTGGGAGAGAAATATTTATTCCCGGATGATAACTCCAACAGGGACTAAAGATAGACTTTTAGTCCTGGTTGGTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 6.50% 0.34% 0.74% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 77.90% 18.80% 0.99% 2.31% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 93.60% 3.00% 0.26% 3.13% NA
Tropical Japonica  504 52.20% 45.20% 2.58% 0.00% NA
Japonica Intermediate  241 81.70% 13.70% 0.00% 4.56% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122205444 G -> T LOC_Os01g39399.1 downstream_gene_variant ; 1643.0bp to feature; MODIFIER silent_mutation Average:59.316; most accessible tissue: Minghui63 flag leaf, score: 78.472 N N N N
vg0122205444 G -> T LOC_Os01g39385-LOC_Os01g39399 intergenic_region ; MODIFIER silent_mutation Average:59.316; most accessible tissue: Minghui63 flag leaf, score: 78.472 N N N N
vg0122205444 G -> DEL N N silent_mutation Average:59.316; most accessible tissue: Minghui63 flag leaf, score: 78.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122205444 NA 1.12E-09 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 1.08E-11 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 3.52E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 1.39E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 3.04E-11 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 2.23E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 8.98E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 1.86E-33 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 1.06E-15 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 2.39E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 9.47E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 7.10E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 8.87E-14 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 1.17E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 1.47E-18 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 8.35E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 1.95E-15 mr1533_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 2.01E-28 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 1.93E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444 NA 9.91E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251