Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122205444:

Variant ID: vg0122205444 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22205444
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTACCAACCAGGACTAAAAGTCTATCTTTAGTCCCTGTTGGAGTTATCATCCGGGAATAAATATTTCTCTCCCACATCTGATCGTTAAGTCCCAGACA[G/T]
ATATTTAGATAAGATTGGATCGTCTTTTCTCTTCCTCCTCTTAGATCCAATCATCTCTCTTCCTCTTCTCGGATCCAATCCCCTTCCTTCTCCCCTCCCC

Reverse complement sequence

GGGGAGGGGAGAAGGAAGGGGATTGGATCCGAGAAGAGGAAGAGAGATGATTGGATCTAAGAGGAGGAAGAGAAAAGACGATCCAATCTTATCTAAATAT[C/A]
TGTCTGGGACTTAACGATCAGATGTGGGAGAGAAATATTTATTCCCGGATGATAACTCCAACAGGGACTAAAGATAGACTTTTAGTCCTGGTTGGTAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.40%	6.50%	0.34%	0.74%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	77.90%	18.80%	0.99%	2.31%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	93.60%	3.00%	0.26%	3.13%	NA
Tropical Japonica	504	52.20%	45.20%	2.58%	0.00%	NA
Japonica Intermediate	241	81.70%	13.70%	0.00%	4.56%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122205444	G -> T	LOC_Os01g39399.1	downstream_gene_variant ; 1643.0bp to feature; MODIFIER	silent_mutation	Average:59.316; most accessible tissue: Minghui63 flag leaf, score: 78.472	N	N	N	N
vg0122205444	G -> T	LOC_Os01g39385-LOC_Os01g39399	intergenic_region ; MODIFIER	silent_mutation	Average:59.316; most accessible tissue: Minghui63 flag leaf, score: 78.472	N	N	N	N
vg0122205444	G -> DEL	N	N	silent_mutation	Average:59.316; most accessible tissue: Minghui63 flag leaf, score: 78.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122205444	NA	1.12E-09	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	1.08E-11	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	3.52E-19	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	1.39E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	3.04E-11	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	2.23E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	8.98E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	1.86E-33	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	1.06E-15	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	2.39E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	9.47E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	7.10E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	8.87E-14	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	1.17E-06	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	1.47E-18	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	8.35E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	1.95E-15	mr1533_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	2.01E-28	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	1.93E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122205444	NA	9.91E-07	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251