\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122176305:

Variant ID: vg0122176305 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22176305
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCTTTAACTCTTTATGCACACCTGCTGGTCCCATGGGACAAGAAAGAATCAAGTAAAATAGTCAAATTATTCACTTTTATGTGTATCTATGCTTGTGC[A/T]
GGAATTGAATTAAACTTATCATATTTTTGTGTATGTTACAAGGCATGACCAATAGAATGCTAGCAAGATACTAGACCTACATTCAATTGAGCATAATTCT

Reverse complement sequence

AGAATTATGCTCAATTGAATGTAGGTCTAGTATCTTGCTAGCATTCTATTGGTCATGCCTTGTAACATACACAAAAATATGATAAGTTTAATTCAATTCC[T/A]
GCACAAGCATAGATACACATAAAAGTGAATAATTTGACTATTTTACTTGATTCTTTCTTGTCCCATGGGACCAGCAGGTGTGCATAAAGAGTTAAAGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 4.90% 0.42% 0.00% NA
All Indica  2759 94.40% 5.40% 0.14% 0.00% NA
All Japonica  1512 93.60% 5.40% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 88.10% 11.80% 0.11% 0.00% NA
Indica Intermediate  786 95.20% 4.50% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.10% 0.39% 0.00% NA
Tropical Japonica  504 87.70% 11.10% 1.19% 0.00% NA
Japonica Intermediate  241 87.10% 10.40% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122176305 A -> T LOC_Os01g39380.1 intron_variant ; MODIFIER silent_mutation Average:44.006; most accessible tissue: Callus, score: 74.864 N N N N
vg0122176305 A -> T LOC_Os01g39380.2 intron_variant ; MODIFIER silent_mutation Average:44.006; most accessible tissue: Callus, score: 74.864 N N N N
vg0122176305 A -> T LOC_Os01g39380.3 intron_variant ; MODIFIER silent_mutation Average:44.006; most accessible tissue: Callus, score: 74.864 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122176305 NA 5.06E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 NA 1.68E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 NA 2.91E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 6.27E-06 1.13E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 NA 5.75E-07 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 NA 1.04E-06 mr1860 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 NA 1.91E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 2.31E-06 6.37E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 1.96E-06 1.67E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 NA 8.79E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 1.28E-07 1.95E-06 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 3.91E-06 NA mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 1.68E-06 1.62E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 3.19E-06 NA mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 1.80E-06 8.36E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122176305 2.88E-06 4.02E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251