\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122155873:

Variant ID: vg0122155873 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22155873
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGATGGACTTTTCTTGTACAGTTCAGCTTCGTGAATAATGTAAAGTCTGCTGCGCCTGGAAATCCGCTCGGCTTCATTTTTGTCTTGAGGGAGTTCTT[A/G]
TTTGGTCAAAAATTTTATGAGAGGTTCTCTCCAGTCGACTTCAAGCATGCTTACGCCTTGAGTATCCATGGCTTCAACTGCTTCTTTTCTGGGCATGGTT

Reverse complement sequence

AACCATGCCCAGAAAAGAAGCAGTTGAAGCCATGGATACTCAAGGCGTAAGCATGCTTGAAGTCGACTGGAGAGAACCTCTCATAAAATTTTTGACCAAA[T/C]
AAGAACTCCCTCAAGACAAAAATGAAGCCGAGCGGATTTCCAGGCGCAGCAGACTTTACATTATTCACGAAGCTGAACTGTACAAGAAAAGTCCATCAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.20% 12.40% 29.39% 22.98% NA
All Indica  2759 12.90% 3.80% 44.76% 38.49% NA
All Japonica  1512 70.50% 23.90% 5.42% 0.20% NA
Aus  269 39.00% 41.60% 16.36% 2.97% NA
Indica I  595 0.00% 2.20% 17.82% 80.00% NA
Indica II  465 5.20% 4.10% 38.06% 52.69% NA
Indica III  913 22.00% 4.80% 64.51% 8.65% NA
Indica Intermediate  786 16.80% 3.70% 46.18% 33.33% NA
Temperate Japonica  767 51.10% 39.50% 9.39% 0.00% NA
Tropical Japonica  504 95.20% 3.80% 0.60% 0.40% NA
Japonica Intermediate  241 80.50% 16.20% 2.90% 0.41% NA
VI/Aromatic  96 89.60% 3.10% 7.29% 0.00% NA
Intermediate  90 54.40% 7.80% 23.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122155873 A -> G LOC_Os01g39360.1 downstream_gene_variant ; 1513.0bp to feature; MODIFIER silent_mutation Average:10.251; most accessible tissue: Zhenshan97 flower, score: 16.6 N N N N
vg0122155873 A -> G LOC_Os01g39370.1 intron_variant ; MODIFIER silent_mutation Average:10.251; most accessible tissue: Zhenshan97 flower, score: 16.6 N N N N
vg0122155873 A -> DEL N N silent_mutation Average:10.251; most accessible tissue: Zhenshan97 flower, score: 16.6 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122155873 NA 2.68E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 7.17E-07 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 9.13E-06 1.20E-09 mr1077 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 1.26E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 1.86E-08 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 1.34E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 1.56E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 1.29E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 6.74E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 1.62E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 4.56E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122155873 NA 2.67E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251