\
| Variant ID: vg0122155873 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22155873 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTGATGGACTTTTCTTGTACAGTTCAGCTTCGTGAATAATGTAAAGTCTGCTGCGCCTGGAAATCCGCTCGGCTTCATTTTTGTCTTGAGGGAGTTCTT[A/G]
TTTGGTCAAAAATTTTATGAGAGGTTCTCTCCAGTCGACTTCAAGCATGCTTACGCCTTGAGTATCCATGGCTTCAACTGCTTCTTTTCTGGGCATGGTT
AACCATGCCCAGAAAAGAAGCAGTTGAAGCCATGGATACTCAAGGCGTAAGCATGCTTGAAGTCGACTGGAGAGAACCTCTCATAAAATTTTTGACCAAA[T/C]
AAGAACTCCCTCAAGACAAAAATGAAGCCGAGCGGATTTCCAGGCGCAGCAGACTTTACATTATTCACGAAGCTGAACTGTACAAGAAAAGTCCATCAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.20% | 12.40% | 29.39% | 22.98% | NA |
| All Indica | 2759 | 12.90% | 3.80% | 44.76% | 38.49% | NA |
| All Japonica | 1512 | 70.50% | 23.90% | 5.42% | 0.20% | NA |
| Aus | 269 | 39.00% | 41.60% | 16.36% | 2.97% | NA |
| Indica I | 595 | 0.00% | 2.20% | 17.82% | 80.00% | NA |
| Indica II | 465 | 5.20% | 4.10% | 38.06% | 52.69% | NA |
| Indica III | 913 | 22.00% | 4.80% | 64.51% | 8.65% | NA |
| Indica Intermediate | 786 | 16.80% | 3.70% | 46.18% | 33.33% | NA |
| Temperate Japonica | 767 | 51.10% | 39.50% | 9.39% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 3.80% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 80.50% | 16.20% | 2.90% | 0.41% | NA |
| VI/Aromatic | 96 | 89.60% | 3.10% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 7.80% | 23.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122155873 | A -> G | LOC_Os01g39360.1 | downstream_gene_variant ; 1513.0bp to feature; MODIFIER | silent_mutation | Average:10.251; most accessible tissue: Zhenshan97 flower, score: 16.6 | N | N | N | N |
| vg0122155873 | A -> G | LOC_Os01g39370.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.251; most accessible tissue: Zhenshan97 flower, score: 16.6 | N | N | N | N |
| vg0122155873 | A -> DEL | N | N | silent_mutation | Average:10.251; most accessible tissue: Zhenshan97 flower, score: 16.6 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122155873 | NA | 2.68E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 7.17E-07 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | 9.13E-06 | 1.20E-09 | mr1077 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 1.26E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 1.86E-08 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 1.34E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 1.56E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 1.29E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 6.74E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 1.62E-09 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 4.56E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122155873 | NA | 2.67E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |