Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122149418:

Variant ID: vg0122149418 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22149418
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

ACGCTTAGCGGCGGCTGGTCCGGTGCTAGCCTTCTCCTGGGCTTGTGTGTTGGCGATGTTGGTGTGTGGGTGGTGGTATTTTTTTTCTTTTTCCTGGTTA[C/T]
GGCCCTCCAGGGTTATAATCTTGTAATTTTTTCCTGCTCTATCAATAGAACTTCGCACCGTCTCGTGCAAGTCGTTCAAAAAAAAAATCTTGTAGCCTGT

Reverse complement sequence

ACAGGCTACAAGATTTTTTTTTTGAACGACTTGCACGAGACGGTGCGAAGTTCTATTGATAGAGCAGGAAAAAATTACAAGATTATAACCCTGGAGGGCC[G/A]
TAACCAGGAAAAAGAAAAAAAATACCACCACCCACACACCAACATCGCCAACACACAAGCCCAGGAGAAGGCTAGCACCGGACCAGCCGCCGCTAAGCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.10%	11.90%	0.00%	0.00%	NA
All Indica	2759	85.70%	14.30%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	45.70%	54.30%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	73.50%	26.50%	0.00%	0.00%	NA
Indica III	913	84.30%	15.70%	0.00%	0.00%	NA
Indica Intermediate	786	83.80%	16.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122149418	C -> T	LOC_Os01g39360.1	upstream_gene_variant ; 2796.0bp to feature; MODIFIER	silent_mutation	Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0122149418	C -> T	LOC_Os01g39340.1	downstream_gene_variant ; 4339.0bp to feature; MODIFIER	silent_mutation	Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0122149418	C -> T	LOC_Os01g39350.1	downstream_gene_variant ; 670.0bp to feature; MODIFIER	silent_mutation	Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N
vg0122149418	C -> T	LOC_Os01g39350-LOC_Os01g39360	intergenic_region ; MODIFIER	silent_mutation	Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122149418	NA	3.72E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	NA	1.50E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	NA	1.15E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	NA	6.57E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	NA	1.12E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	3.64E-06	1.27E-08	mr1684	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	7.82E-06	NA	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	NA	2.46E-06	mr1725	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	9.48E-06	1.46E-06	mr1796	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	NA	1.10E-08	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	NA	3.95E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418	NA	7.58E-06	mr1981	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251