\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122149418:

Variant ID: vg0122149418 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22149418
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCTTAGCGGCGGCTGGTCCGGTGCTAGCCTTCTCCTGGGCTTGTGTGTTGGCGATGTTGGTGTGTGGGTGGTGGTATTTTTTTTCTTTTTCCTGGTTA[C/T]
GGCCCTCCAGGGTTATAATCTTGTAATTTTTTCCTGCTCTATCAATAGAACTTCGCACCGTCTCGTGCAAGTCGTTCAAAAAAAAAATCTTGTAGCCTGT

Reverse complement sequence

ACAGGCTACAAGATTTTTTTTTTGAACGACTTGCACGAGACGGTGCGAAGTTCTATTGATAGAGCAGGAAAAAATTACAAGATTATAACCCTGGAGGGCC[G/A]
TAACCAGGAAAAAGAAAAAAAATACCACCACCCACACACCAACATCGCCAACACACAAGCCCAGGAGAAGGCTAGCACCGGACCAGCCGCCGCTAAGCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.10% 11.90% 0.00% 0.00% NA
All Indica  2759 85.70% 14.30% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 45.70% 54.30% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 73.50% 26.50% 0.00% 0.00% NA
Indica III  913 84.30% 15.70% 0.00% 0.00% NA
Indica Intermediate  786 83.80% 16.20% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122149418 C -> T LOC_Os01g39360.1 upstream_gene_variant ; 2796.0bp to feature; MODIFIER silent_mutation Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0122149418 C -> T LOC_Os01g39340.1 downstream_gene_variant ; 4339.0bp to feature; MODIFIER silent_mutation Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0122149418 C -> T LOC_Os01g39350.1 downstream_gene_variant ; 670.0bp to feature; MODIFIER silent_mutation Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N
vg0122149418 C -> T LOC_Os01g39350-LOC_Os01g39360 intergenic_region ; MODIFIER silent_mutation Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122149418 NA 3.72E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 NA 1.50E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 NA 1.15E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 NA 6.57E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 NA 1.12E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 3.64E-06 1.27E-08 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 7.82E-06 NA mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 NA 2.46E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 9.48E-06 1.46E-06 mr1796 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 NA 1.10E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 NA 3.95E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122149418 NA 7.58E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251