\
| Variant ID: vg0122149418 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22149418 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )
ACGCTTAGCGGCGGCTGGTCCGGTGCTAGCCTTCTCCTGGGCTTGTGTGTTGGCGATGTTGGTGTGTGGGTGGTGGTATTTTTTTTCTTTTTCCTGGTTA[C/T]
GGCCCTCCAGGGTTATAATCTTGTAATTTTTTCCTGCTCTATCAATAGAACTTCGCACCGTCTCGTGCAAGTCGTTCAAAAAAAAAATCTTGTAGCCTGT
ACAGGCTACAAGATTTTTTTTTTGAACGACTTGCACGAGACGGTGCGAAGTTCTATTGATAGAGCAGGAAAAAATTACAAGATTATAACCCTGGAGGGCC[G/A]
TAACCAGGAAAAAGAAAAAAAATACCACCACCCACACACCAACATCGCCAACACACAAGCCCAGGAGAAGGCTAGCACCGGACCAGCCGCCGCTAAGCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 45.70% | 54.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 73.50% | 26.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.80% | 16.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122149418 | C -> T | LOC_Os01g39360.1 | upstream_gene_variant ; 2796.0bp to feature; MODIFIER | silent_mutation | Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| vg0122149418 | C -> T | LOC_Os01g39340.1 | downstream_gene_variant ; 4339.0bp to feature; MODIFIER | silent_mutation | Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| vg0122149418 | C -> T | LOC_Os01g39350.1 | downstream_gene_variant ; 670.0bp to feature; MODIFIER | silent_mutation | Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| vg0122149418 | C -> T | LOC_Os01g39350-LOC_Os01g39360 | intergenic_region ; MODIFIER | silent_mutation | Average:65.631; most accessible tissue: Zhenshan97 flower, score: 81.047 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122149418 | NA | 3.72E-07 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | NA | 1.50E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | NA | 1.15E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | NA | 6.57E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | NA | 1.12E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | 3.64E-06 | 1.27E-08 | mr1684 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | 7.82E-06 | NA | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | NA | 2.46E-06 | mr1725 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | 9.48E-06 | 1.46E-06 | mr1796 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | NA | 1.10E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | NA | 3.95E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122149418 | NA | 7.58E-06 | mr1981 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |