\
| Variant ID: vg0122125670 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22125670 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 259. )
CCATGTTATTAGTGCATTTATTTACTGATATTATTATCTTGATTTGTTCTTATACCAATGTTTCCTTGCCTTTTAGCTTGTCAACCCTGCATACCAAAAT[A/C]
TTTTGGATCATTTACGGACTAGAACTTTAGAAGTATTTAAGGAGTCCTTTGACAAGTCCCTAGAAAAGGAGGGTTTTGCTGTTGCTGCTCGTGACTGTAC
GTACAGTCACGAGCAGCAACAGCAAAACCCTCCTTTTCTAGGGACTTGTCAAAGGACTCCTTAAATACTTCTAAAGTTCTAGTCCGTAAATGATCCAAAA[T/G]
ATTTTGGTATGCAGGGTTGACAAGCTAAAAGGCAAGGAAACATTGGTATAAGAACAAATCAAGATAATAATATCAGTAAATAAATGCACTAATAACATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 44.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 85.80% | 14.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.70% | 27.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.10% | 6.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.20% | 16.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122125670 | A -> C | LOC_Os01g39310.1 | missense_variant ; p.Ile370Leu; MODERATE | nonsynonymous_codon ; I370L | Average:54.484; most accessible tissue: Zhenshan97 root, score: 66.982 | benign |
-1.22 |
TOLERATED | 0.38 |
| vg0122125670 | A -> C | LOC_Os01g39310.3 | missense_variant ; p.Ile370Leu; MODERATE | nonsynonymous_codon ; I370L | Average:54.484; most accessible tissue: Zhenshan97 root, score: 66.982 | benign |
-1.22 |
TOLERATED | 0.43 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122125670 | NA | 2.89E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 2.11E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 2.94E-06 | mr1156 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 2.35E-17 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 4.30E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 1.18E-42 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 1.33E-26 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 7.80E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 2.06E-23 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 7.56E-07 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | 6.58E-06 | 6.59E-06 | mr1747_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 2.32E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122125670 | NA | 6.81E-06 | mr1888_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |