\
| Variant ID: vg0122081051 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22081051 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.20, others allele: 0.00, population size: 112. )
CGTGAATTTGCCCGATGACACTCTAAAAGTGTGGTAATTTATTGTATGACACTAGGCGCATTAAAATATAATTTCCACTAAATTGATGAGAGAGAAACCA[C/T]
GTAAAATGGCGGTTTTGCACCTTCTCTCCCCCTTCTCCTCTATTTTTTTCCTCTTCCTCTCATTGACTCTCCCTCTCTCTCTTTCTCTGCTTCTTTCTCA
TGAGAAAGAAGCAGAGAAAGAGAGAGAGGGAGAGTCAATGAGAGGAAGAGGAAAAAAATAGAGGAGAAGGGGGAGAGAAGGTGCAAAACCGCCATTTTAC[G/A]
TGGTTTCTCTCTCATCAATTTAGTGGAAATTATATTTTAATGCGCCTAGTGTCATACAATAAATTACCACACTTTTAGAGTGTCATCGGGCAAATTCACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 43.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 89.70% | 10.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.60% | 15.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 66.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122081051 | C -> T | LOC_Os01g39260.1 | upstream_gene_variant ; 1205.0bp to feature; MODIFIER | silent_mutation | Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0122081051 | C -> T | LOC_Os01g39250.1 | downstream_gene_variant ; 1190.0bp to feature; MODIFIER | silent_mutation | Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0122081051 | C -> T | LOC_Os01g39250-LOC_Os01g39260 | intergenic_region ; MODIFIER | silent_mutation | Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122081051 | NA | 1.25E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 3.68E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 2.49E-18 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 1.79E-25 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 4.63E-45 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 5.66E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 1.27E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 4.18E-62 | mr1671 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 3.09E-21 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 1.35E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 2.70E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 7.39E-23 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 1.86E-39 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 7.80E-26 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 2.86E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 1.91E-86 | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 1.26E-06 | mr1733_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | 2.37E-06 | NA | mr1788_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122081051 | NA | 4.00E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |