\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122081051:

Variant ID: vg0122081051 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22081051
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.20, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGAATTTGCCCGATGACACTCTAAAAGTGTGGTAATTTATTGTATGACACTAGGCGCATTAAAATATAATTTCCACTAAATTGATGAGAGAGAAACCA[C/T]
GTAAAATGGCGGTTTTGCACCTTCTCTCCCCCTTCTCCTCTATTTTTTTCCTCTTCCTCTCATTGACTCTCCCTCTCTCTCTTTCTCTGCTTCTTTCTCA

Reverse complement sequence

TGAGAAAGAAGCAGAGAAAGAGAGAGAGGGAGAGTCAATGAGAGGAAGAGGAAAAAAATAGAGGAGAAGGGGGAGAGAAGGTGCAAAACCGCCATTTTAC[G/A]
TGGTTTCTCTCTCATCAATTTAGTGGAAATTATATTTTAATGCGCCTAGTGTCATACAATAAATTACCACACTTTTAGAGTGTCATCGGGCAAATTCACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 43.70% 0.06% 0.00% NA
All Indica  2759 89.70% 10.10% 0.11% 0.00% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 50.60% 49.40% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 85.90% 14.10% 0.00% 0.00% NA
Indica Intermediate  786 84.60% 15.00% 0.38% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122081051 C -> T LOC_Os01g39260.1 upstream_gene_variant ; 1205.0bp to feature; MODIFIER silent_mutation Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0122081051 C -> T LOC_Os01g39250.1 downstream_gene_variant ; 1190.0bp to feature; MODIFIER silent_mutation Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg0122081051 C -> T LOC_Os01g39250-LOC_Os01g39260 intergenic_region ; MODIFIER silent_mutation Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122081051 NA 1.25E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 3.68E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 2.49E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 1.79E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 4.63E-45 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 5.66E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 1.27E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 4.18E-62 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 3.09E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 1.35E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 2.70E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 7.39E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 1.86E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 7.80E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 2.86E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 1.91E-86 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 1.26E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 2.37E-06 NA mr1788_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051 NA 4.00E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251