Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122081051:

Variant ID: vg0122081051 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22081051
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.20, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGAATTTGCCCGATGACACTCTAAAAGTGTGGTAATTTATTGTATGACACTAGGCGCATTAAAATATAATTTCCACTAAATTGATGAGAGAGAAACCA[C/T]
GTAAAATGGCGGTTTTGCACCTTCTCTCCCCCTTCTCCTCTATTTTTTTCCTCTTCCTCTCATTGACTCTCCCTCTCTCTCTTTCTCTGCTTCTTTCTCA

Reverse complement sequence

TGAGAAAGAAGCAGAGAAAGAGAGAGAGGGAGAGTCAATGAGAGGAAGAGGAAAAAAATAGAGGAGAAGGGGGAGAGAAGGTGCAAAACCGCCATTTTAC[G/A]
TGGTTTCTCTCTCATCAATTTAGTGGAAATTATATTTTAATGCGCCTAGTGTCATACAATAAATTACCACACTTTTAGAGTGTCATCGGGCAAATTCACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	43.70%	0.06%	0.00%	NA
All Indica	2759	89.70%	10.10%	0.11%	0.00%	NA
All Japonica	1512	0.40%	99.60%	0.00%	0.00%	NA
Aus	269	50.60%	49.40%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	95.10%	4.90%	0.00%	0.00%	NA
Indica III	913	85.90%	14.10%	0.00%	0.00%	NA
Indica Intermediate	786	84.60%	15.00%	0.38%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	33.30%	66.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122081051	C -> T	LOC_Os01g39260.1	upstream_gene_variant ; 1205.0bp to feature; MODIFIER	silent_mutation	Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N
vg0122081051	C -> T	LOC_Os01g39250.1	downstream_gene_variant ; 1190.0bp to feature; MODIFIER	silent_mutation	Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N
vg0122081051	C -> T	LOC_Os01g39250-LOC_Os01g39260	intergenic_region ; MODIFIER	silent_mutation	Average:70.036; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122081051	NA	1.25E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	3.68E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	2.49E-18	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	1.79E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	4.63E-45	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	5.66E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	1.27E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	4.18E-62	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	3.09E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	1.35E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	2.70E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	7.39E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	1.86E-39	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	7.80E-26	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	2.86E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	1.91E-86	mr1671_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	1.26E-06	mr1733_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	2.37E-06	NA	mr1788_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122081051	NA	4.00E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251