Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122073422:

Variant ID: vg0122073422 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22073422
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, T: 0.16, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTCATACGGACTCGGAATCAGGCAAATAATATATCCACGGACATCTATAGAAAAAGTTACATCCGATTCTTCTTAGCCTTGTCGGGTTTGGATAAATT[A/T]
TAACCTCTAAATTCCACTTACAAGATTGTGTTTTCGAGGTGATGAGCTTTTCGGTAGAGCTTTGAAAAATTCTACATGTCATATATTTCATCCATTTGAG

Reverse complement sequence

CTCAAATGGATGAAATATATGACATGTAGAATTTTTCAAAGCTCTACCGAAAAGCTCATCACCTCGAAAACACAATCTTGTAAGTGGAATTTAGAGGTTA[T/A]
AATTTATCCAAACCCGACAAGGCTAAGAAGAATCGGATGTAACTTTTTCTATAGATGTCCGTGGATATATTATTTGCCTGATTCCGAGTCCGTATGAGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.70% 0.17% 0.00% NA
All Indica  2759 89.50% 10.30% 0.22% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.07% 0.00% NA
Aus  269 50.60% 49.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.20% 0.34% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 85.10% 14.80% 0.11% 0.00% NA
Indica Intermediate  786 84.50% 15.10% 0.38% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.00% 0.20% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 32.20% 66.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122073422 A -> T LOC_Os01g39250.1 upstream_gene_variant ; 961.0bp to feature; MODIFIER silent_mutation Average:41.741; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0122073422 A -> T LOC_Os01g39230-LOC_Os01g39250 intergenic_region ; MODIFIER silent_mutation Average:41.741; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122073422 NA 3.83E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.67E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.37E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 6.21E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.64E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 2.36E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 2.87E-45 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 9.27E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.12E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.93E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 4.43E-06 2.07E-65 mr1671 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 2.96E-22 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.95E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 6.88E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 6.30E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 5.21E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.12E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.09E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 2.28E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 5.16E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.14E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.45E-85 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 7.52E-06 1.81E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122073422 NA 1.53E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251