\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122065864:

Variant ID: vg0122065864 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22065864
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAGAAAAAGCCTAGAACCCTTCTCGTCTCCCCCTACCCTCGCCTCGCCGTCGCCGCCGGCGAAATTTTTTCCTCCGCTCGCCGTCGCCTCCGAACCTC[C/T]
TGCACCGACCCTTCGTTCCGCACAGATACTCCTCCCACCCACCCACCCCTAGGTGCTTGGTTGGTTGGGAGTCGGGGATCTCGTGGAAGCAGATGCGGCG

Reverse complement sequence

CGCCGCATCTGCTTCCACGAGATCCCCGACTCCCAACCAACCAAGCACCTAGGGGTGGGTGGGTGGGAGGAGTATCTGTGCGGAACGAAGGGTCGGTGCA[G/A]
GAGGTTCGGAGGCGACGGCGAGCGGAGGAAAAAATTTCGCCGGCGGCGACGGCGAGGCGAGGGTAGGGGGAGACGAGAAGGGTTCTAGGCTTTTTCTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 28.00% 16.89% 0.99% NA
All Indica  2759 26.20% 44.70% 27.36% 1.70% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 63.20% 25.30% 11.52% 0.00% NA
Indica I  595 13.10% 45.40% 38.66% 2.86% NA
Indica II  465 21.10% 49.70% 27.31% 1.94% NA
Indica III  913 34.70% 43.20% 21.25% 0.88% NA
Indica Intermediate  786 29.30% 43.10% 25.95% 1.65% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 74.40% 13.30% 12.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122065864 C -> T LOC_Os01g39210.1 upstream_gene_variant ; 4453.0bp to feature; MODIFIER silent_mutation Average:80.853; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg0122065864 C -> T LOC_Os01g39220.1 downstream_gene_variant ; 1124.0bp to feature; MODIFIER silent_mutation Average:80.853; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg0122065864 C -> T LOC_Os01g39230.1 downstream_gene_variant ; 1934.0bp to feature; MODIFIER silent_mutation Average:80.853; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg0122065864 C -> T LOC_Os01g39220-LOC_Os01g39230 intergenic_region ; MODIFIER silent_mutation Average:80.853; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg0122065864 C -> DEL N N silent_mutation Average:80.853; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122065864 C T -0.09 -0.07 -0.07 -0.07 -0.08 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122065864 NA 1.22E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 3.53E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 2.16E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 5.95E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 7.05E-46 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 4.53E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 3.37E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 3.69E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 1.11E-61 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 8.01E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 5.73E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 3.19E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 1.02E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 1.55E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 1.48E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 1.66E-25 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 3.15E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 NA 3.56E-79 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122065864 2.53E-06 NA mr1723_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251