| Variant ID: vg0122048209 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22048209 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 268. )
TGAGCTTCCGCAATAGAAGAGATTGTCATGACCGTCACAATTGCTGCATGTTTGCCCCATTTGTATGTGGTTAGCCTTCTATTTTCTTCTCATTAGAGAC[G/T]
GCTACAACATCTTTGATTTAACAAGATAGATCTATGTTTCTTTTTTGAAAAAAAAGTAATCATTGTCGGATCAATGTTTTGGAGAAAGAAAAAAGGGGAA
TTCCCCTTTTTTCTTTCTCCAAAACATTGATCCGACAATGATTACTTTTTTTTCAAAAAAGAAACATAGATCTATCTTGTTAAATCAAAGATGTTGTAGC[C/A]
GTCTCTAATGAGAAGAAAATAGAAGGCTAACCACATACAAATGGGGCAAACATGCAGCAATTGTGACGGTCATGACAATCTCTTCTATTGCGGAAGCTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 5.70% | 3.85% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 72.00% | 16.90% | 11.11% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.00% | 1.49% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 51.50% | 30.00% | 18.51% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 1.20% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 8.30% | 7.47% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122048209 | G -> T | LOC_Os01g39180.1 | downstream_gene_variant ; 2895.0bp to feature; MODIFIER | silent_mutation | Average:36.685; most accessible tissue: Callus, score: 59.803 | N | N | N | N |
| vg0122048209 | G -> T | LOC_Os01g39190.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.685; most accessible tissue: Callus, score: 59.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122048209 | NA | 8.21E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | NA | 3.03E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | NA | 2.73E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | NA | 2.28E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | NA | 4.96E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | NA | 2.58E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | NA | 1.17E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | NA | 2.69E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | NA | 1.12E-08 | mr1548 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122048209 | 9.56E-07 | 1.99E-11 | mr1627 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/