\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122037982:

Variant ID: vg0122037982 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22037982
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTTGCTAGTCATAAAAGCGGTCGTCTTTAGACTTTTTTTTAAGTCAACAAGCTTGACCACCTAAAATCCTTTTACATAAATCCAAAATAAGTAAAATT[T/A]
TTTTATTTTAACAAATCAAATTTATTATTTTCATATATATGCTCAAAATCTATGTTCTAAACAATAATTGTGGTGAAATTTTAAGTTACTTTTGTAGACC

Reverse complement sequence

GGTCTACAAAAGTAACTTAAAATTTCACCACAATTATTGTTTAGAACATAGATTTTGAGCATATATATGAAAATAATAAATTTGATTTGTTAAAATAAAA[A/T]
AATTTTACTTATTTTGGATTTATGTAAAAGGATTTTAGGTGGTCAAGCTTGTTGACTTAAAAAAAAGTCTAAAGACGACCGCTTTTATGACTAGCAAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 5.60% 3.32% 0.00% NA
All Indica  2759 99.50% 0.30% 0.18% 0.00% NA
All Japonica  1512 73.50% 16.70% 9.72% 0.00% NA
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.30% 0.38% 0.00% NA
Temperate Japonica  767 54.10% 29.60% 16.30% 0.00% NA
Tropical Japonica  504 97.60% 1.20% 1.19% 0.00% NA
Japonica Intermediate  241 85.10% 8.30% 6.64% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122037982 T -> A LOC_Os01g39136.1 upstream_gene_variant ; 3971.0bp to feature; MODIFIER silent_mutation Average:49.828; most accessible tissue: Callus, score: 78.62 N N N N
vg0122037982 T -> A LOC_Os01g39160.1 upstream_gene_variant ; 1608.0bp to feature; MODIFIER silent_mutation Average:49.828; most accessible tissue: Callus, score: 78.62 N N N N
vg0122037982 T -> A LOC_Os01g39170.1 upstream_gene_variant ; 2649.0bp to feature; MODIFIER silent_mutation Average:49.828; most accessible tissue: Callus, score: 78.62 N N N N
vg0122037982 T -> A LOC_Os01g39180.1 upstream_gene_variant ; 4948.0bp to feature; MODIFIER silent_mutation Average:49.828; most accessible tissue: Callus, score: 78.62 N N N N
vg0122037982 T -> A LOC_Os01g39150.1 downstream_gene_variant ; 397.0bp to feature; MODIFIER silent_mutation Average:49.828; most accessible tissue: Callus, score: 78.62 N N N N
vg0122037982 T -> A LOC_Os01g39150-LOC_Os01g39160 intergenic_region ; MODIFIER silent_mutation Average:49.828; most accessible tissue: Callus, score: 78.62 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122037982 NA 7.63E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 4.06E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 1.32E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 7.81E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 9.68E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 1.94E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 8.61E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 2.18E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 1.56E-07 NA mr1627 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 3.95E-10 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 3.48E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122037982 NA 1.02E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251