\
| Variant ID: vg0122037982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22037982 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCTTGCTAGTCATAAAAGCGGTCGTCTTTAGACTTTTTTTTAAGTCAACAAGCTTGACCACCTAAAATCCTTTTACATAAATCCAAAATAAGTAAAATT[T/A]
TTTTATTTTAACAAATCAAATTTATTATTTTCATATATATGCTCAAAATCTATGTTCTAAACAATAATTGTGGTGAAATTTTAAGTTACTTTTGTAGACC
GGTCTACAAAAGTAACTTAAAATTTCACCACAATTATTGTTTAGAACATAGATTTTGAGCATATATATGAAAATAATAAATTTGATTTGTTAAAATAAAA[A/T]
AATTTTACTTATTTTGGATTTATGTAAAAGGATTTTAGGTGGTCAAGCTTGTTGACTTAAAAAAAAGTCTAAAGACGACCGCTTTTATGACTAGCAAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 5.60% | 3.32% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 73.50% | 16.70% | 9.72% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.40% | 1.12% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 54.10% | 29.60% | 16.30% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 1.20% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 8.30% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122037982 | T -> A | LOC_Os01g39136.1 | upstream_gene_variant ; 3971.0bp to feature; MODIFIER | silent_mutation | Average:49.828; most accessible tissue: Callus, score: 78.62 | N | N | N | N |
| vg0122037982 | T -> A | LOC_Os01g39160.1 | upstream_gene_variant ; 1608.0bp to feature; MODIFIER | silent_mutation | Average:49.828; most accessible tissue: Callus, score: 78.62 | N | N | N | N |
| vg0122037982 | T -> A | LOC_Os01g39170.1 | upstream_gene_variant ; 2649.0bp to feature; MODIFIER | silent_mutation | Average:49.828; most accessible tissue: Callus, score: 78.62 | N | N | N | N |
| vg0122037982 | T -> A | LOC_Os01g39180.1 | upstream_gene_variant ; 4948.0bp to feature; MODIFIER | silent_mutation | Average:49.828; most accessible tissue: Callus, score: 78.62 | N | N | N | N |
| vg0122037982 | T -> A | LOC_Os01g39150.1 | downstream_gene_variant ; 397.0bp to feature; MODIFIER | silent_mutation | Average:49.828; most accessible tissue: Callus, score: 78.62 | N | N | N | N |
| vg0122037982 | T -> A | LOC_Os01g39150-LOC_Os01g39160 | intergenic_region ; MODIFIER | silent_mutation | Average:49.828; most accessible tissue: Callus, score: 78.62 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122037982 | NA | 7.63E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 4.06E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 1.32E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 7.81E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 9.68E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 1.94E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 8.61E-08 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 2.18E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | 1.56E-07 | NA | mr1627 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 3.95E-10 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 3.48E-08 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122037982 | NA | 1.02E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |