\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122034730:

Variant ID: vg0122034730 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22034730
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CAAATGAGAGGGAGAGGAAATAAATGGAGGAAGATAGATAGGATTTTTAGCCTCAAAATATATGGCATGGGTTTCAAAGAATTGTCTGAGGCTAATAGGA[T/G]
ATTTGGATAGAATTTGAATTTAAAGAAGATTTGGATGACAAGGATATAATATATTATCTTAGCACAAGAGCAATTATTCACAATGTTTGTAATAATATTA

Reverse complement sequence

TAATATTATTACAAACATTGTGAATAATTGCTCTTGTGCTAAGATAATATATTATATCCTTGTCATCCAAATCTTCTTTAAATTCAAATTCTATCCAAAT[A/C]
TCCTATTAGCCTCAGACAATTCTTTGAAACCCATGCCATATATTTTGAGGCTAAAAATCCTATCTATCTTCCTCCATTTATTTCCTCTCCCTCTCATTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 42.40% 0.15% 0.00% NA
All Indica  2759 91.90% 8.00% 0.14% 0.00% NA
All Japonica  1512 0.30% 99.70% 0.07% 0.00% NA
Aus  269 52.00% 48.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.30% 0.34% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 87.20% 12.80% 0.00% 0.00% NA
Indica Intermediate  786 88.90% 10.80% 0.25% 0.00% NA
Temperate Japonica  767 0.00% 99.90% 0.13% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122034730 T -> G LOC_Os01g39136.1 upstream_gene_variant ; 719.0bp to feature; MODIFIER silent_mutation Average:35.09; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0122034730 T -> G LOC_Os01g39150.1 upstream_gene_variant ; 2100.0bp to feature; MODIFIER silent_mutation Average:35.09; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0122034730 T -> G LOC_Os01g39160.1 upstream_gene_variant ; 4860.0bp to feature; MODIFIER silent_mutation Average:35.09; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0122034730 T -> G LOC_Os01g39136-LOC_Os01g39150 intergenic_region ; MODIFIER silent_mutation Average:35.09; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122034730 NA 1.97E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 1.10E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 2.21E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 2.28E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 2.74E-48 mr1591 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 4.81E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 3.11E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 2.16E-11 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 4.89E-63 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 1.78E-20 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 7.99E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 1.40E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 2.49E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 2.27E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 4.37E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 6.16E-27 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 1.94E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 2.28E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 1.91E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730 NA 1.74E-83 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251