Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122034730:

Variant ID: vg0122034730 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22034730
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CAAATGAGAGGGAGAGGAAATAAATGGAGGAAGATAGATAGGATTTTTAGCCTCAAAATATATGGCATGGGTTTCAAAGAATTGTCTGAGGCTAATAGGA[T/G]
ATTTGGATAGAATTTGAATTTAAAGAAGATTTGGATGACAAGGATATAATATATTATCTTAGCACAAGAGCAATTATTCACAATGTTTGTAATAATATTA

Reverse complement sequence

TAATATTATTACAAACATTGTGAATAATTGCTCTTGTGCTAAGATAATATATTATATCCTTGTCATCCAAATCTTCTTTAAATTCAAATTCTATCCAAAT[A/C]
TCCTATTAGCCTCAGACAATTCTTTGAAACCCATGCCATATATTTTGAGGCTAAAAATCCTATCTATCTTCCTCCATTTATTTCCTCTCCCTCTCATTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	42.40%	0.15%	0.00%	NA
All Indica	2759	91.90%	8.00%	0.14%	0.00%	NA
All Japonica	1512	0.30%	99.70%	0.07%	0.00%	NA
Aus	269	52.00%	48.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.30%	0.34%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	87.20%	12.80%	0.00%	0.00%	NA
Indica Intermediate	786	88.90%	10.80%	0.25%	0.00%	NA
Temperate Japonica	767	0.00%	99.90%	0.13%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	38.90%	58.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122034730	T -> G	LOC_Os01g39136.1	upstream_gene_variant ; 719.0bp to feature; MODIFIER	silent_mutation	Average:35.09; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0122034730	T -> G	LOC_Os01g39150.1	upstream_gene_variant ; 2100.0bp to feature; MODIFIER	silent_mutation	Average:35.09; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0122034730	T -> G	LOC_Os01g39160.1	upstream_gene_variant ; 4860.0bp to feature; MODIFIER	silent_mutation	Average:35.09; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0122034730	T -> G	LOC_Os01g39136-LOC_Os01g39150	intergenic_region ; MODIFIER	silent_mutation	Average:35.09; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122034730	NA	1.97E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	1.10E-09	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	2.21E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	2.28E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	2.74E-48	mr1591	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	4.81E-58	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	3.11E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	2.16E-11	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	4.89E-63	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	1.78E-20	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	7.99E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	1.40E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	2.49E-24	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	2.27E-39	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	4.37E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	6.16E-27	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	1.94E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	2.28E-26	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	1.91E-13	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122034730	NA	1.74E-83	mr1671_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251