\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122011839:

Variant ID: vg0122011839 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22011839
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GACATCTAAACAAAATTCTCTACAACTTTCATGTGGGTGAAAAATCAGATTAAGCCTATGTAAGTCCCATATAAAGGAAAATGAATTGTTGTCCTGGTTT[C/T]
CGGACCTGGTCAGCAGTACTTTTTTGGTTGTTTCTTATCAGAATCGAGTGAAACCAGCACCGTTAGAAAGATATCGACGATGACTACAAACTTTATTTAG

Reverse complement sequence

CTAAATAAAGTTTGTAGTCATCGTCGATATCTTTCTAACGGTGCTGGTTTCACTCGATTCTGATAAGAAACAACCAAAAAAGTACTGCTGACCAGGTCCG[G/A]
AAACCAGGACAACAATTCATTTTCCTTTATATGGGACTTACATAGGCTTAATCTGATTTTTCACCCACATGAAAGTTGTAGAGAATTTTGTTTAGATGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 16.30% 0.70% 0.00% NA
All Indica  2759 83.30% 16.20% 0.43% 0.00% NA
All Japonica  1512 89.00% 9.90% 1.19% 0.00% NA
Aus  269 39.80% 59.50% 0.74% 0.00% NA
Indica I  595 98.20% 1.30% 0.50% 0.00% NA
Indica II  465 79.40% 20.40% 0.22% 0.00% NA
Indica III  913 82.10% 17.60% 0.22% 0.00% NA
Indica Intermediate  786 75.80% 23.40% 0.76% 0.00% NA
Temperate Japonica  767 97.50% 2.00% 0.52% 0.00% NA
Tropical Japonica  504 81.90% 17.50% 0.60% 0.00% NA
Japonica Intermediate  241 76.30% 19.10% 4.56% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122011839 C -> T LOC_Os01g39120-LOC_Os01g39134 intergenic_region ; MODIFIER silent_mutation Average:37.945; most accessible tissue: Zhenshan97 young leaf, score: 53.314 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122011839 NA 6.42E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839 NA 8.64E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839 2.49E-07 1.32E-08 mr1113_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839 NA 4.18E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839 NA 2.05E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839 NA 2.90E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839 NA 5.59E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839 NA 2.28E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839 NA 3.99E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251