Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122011839:

Variant ID: vg0122011839 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22011839
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

GACATCTAAACAAAATTCTCTACAACTTTCATGTGGGTGAAAAATCAGATTAAGCCTATGTAAGTCCCATATAAAGGAAAATGAATTGTTGTCCTGGTTT[C/T]
CGGACCTGGTCAGCAGTACTTTTTTGGTTGTTTCTTATCAGAATCGAGTGAAACCAGCACCGTTAGAAAGATATCGACGATGACTACAAACTTTATTTAG

Reverse complement sequence

CTAAATAAAGTTTGTAGTCATCGTCGATATCTTTCTAACGGTGCTGGTTTCACTCGATTCTGATAAGAAACAACCAAAAAAGTACTGCTGACCAGGTCCG[G/A]
AAACCAGGACAACAATTCATTTTCCTTTATATGGGACTTACATAGGCTTAATCTGATTTTTCACCCACATGAAAGTTGTAGAGAATTTTGTTTAGATGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	16.30%	0.70%	0.00%	NA
All Indica	2759	83.30%	16.20%	0.43%	0.00%	NA
All Japonica	1512	89.00%	9.90%	1.19%	0.00%	NA
Aus	269	39.80%	59.50%	0.74%	0.00%	NA
Indica I	595	98.20%	1.30%	0.50%	0.00%	NA
Indica II	465	79.40%	20.40%	0.22%	0.00%	NA
Indica III	913	82.10%	17.60%	0.22%	0.00%	NA
Indica Intermediate	786	75.80%	23.40%	0.76%	0.00%	NA
Temperate Japonica	767	97.50%	2.00%	0.52%	0.00%	NA
Tropical Japonica	504	81.90%	17.50%	0.60%	0.00%	NA
Japonica Intermediate	241	76.30%	19.10%	4.56%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122011839	C -> T	LOC_Os01g39120-LOC_Os01g39134	intergenic_region ; MODIFIER	silent_mutation	Average:37.945; most accessible tissue: Zhenshan97 young leaf, score: 53.314	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122011839	NA	6.42E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839	NA	8.64E-07	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839	2.49E-07	1.32E-08	mr1113_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839	NA	4.18E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839	NA	2.05E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839	NA	2.90E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839	NA	5.59E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839	NA	2.28E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122011839	NA	3.99E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251