Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121993603:

Variant ID: vg0121993603 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21993603
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCATTGCTTCCATGGTGAGGCAGATGCTGCATGCTATGTAGCAAGAAAAGATCGAAGCTCCTATGTTTCATCACCATCTTCAGCAGCAGCAGCAGCAG[G/C]
AGGAGGAGGAGGGAGGAGGATTGTTCTTGGTGGAAGAGGCCGCCGAGGCAGCAGATCAGCAGCAGGAGAGCAGCATGTCCAACCTGACCTCCTCCGCCTC

Reverse complement sequence

GAGGCGGAGGAGGTCAGGTTGGACATGCTGCTCTCCTGCTGCTGATCTGCTGCCTCGGCGGCCTCTTCCACCAAGAACAATCCTCCTCCCTCCTCCTCCT[C/G]
CTGCTGCTGCTGCTGCTGAAGATGGTGATGAAACATAGGAGCTTCGATCTTTTCTTGCTACATAGCATGCAGCATCTGCCTCACCATGGAAGCAATGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.50% 0.30% 0.00% NA
All Indica  2759 43.00% 56.50% 0.47% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 7.90% 91.80% 0.34% 0.00% NA
Indica II  465 16.80% 82.80% 0.43% 0.00% NA
Indica III  913 74.80% 24.60% 0.55% 0.00% NA
Indica Intermediate  786 48.10% 51.40% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121993603 G -> C LOC_Os01g39110.1 missense_variant ; p.Glu13Gln; MODERATE nonsynonymous_codon ; E13Q Average:78.685; most accessible tissue: Minghui63 panicle, score: 89.702 unknown unknown TOLERATED 0.30

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0121993603 G C -0.01 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121993603 NA 5.70E-36 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.26E-45 mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 4.64E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 2.99E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.99E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.83E-20 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.22E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 7.50E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 2.89E-20 mr1870 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 3.25E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.07E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.47E-20 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.04E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 8.90E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.12E-20 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121993603 NA 1.81E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251