Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121835877:

Variant ID: vg0121835877 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21835877
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TGACTCCTATGTCCGATTCCCTTTCAGAAAAGAAAAAAAAGTCTGATTCTACATTGGTGAAAAAAATTGATGTGCCGAATTAAAGATCTGTTTGCAAAAA[C/T]
GAAACCTACATGTCGAGAGCATTCCATTTTTATATTATTTTAATTATTGGGTTTATACTTTTGCATTTGAGTCACTGTAATTTTTATATTTATATTTGAG

Reverse complement sequence

CTCAAATATAAATATAAAAATTACAGTGACTCAAATGCAAAAGTATAAACCCAATAATTAAAATAATATAAAAATGGAATGCTCTCGACATGTAGGTTTC[G/A]
TTTTTGCAAACAGATCTTTAATTCGGCACATCAATTTTTTTCACCAATGTAGAATCAGACTTTTTTTTCTTTTCTGAAAGGGAATCGGACATAGGAGTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.50%	27.80%	1.61%	21.03%	NA
All Indica	2759	19.30%	47.10%	2.46%	31.10%	NA
All Japonica	1512	99.60%	0.20%	0.00%	0.20%	NA
Aus	269	53.50%	0.00%	2.23%	44.24%	NA
Indica I	595	1.20%	91.30%	1.34%	6.22%	NA
Indica II	465	25.20%	65.40%	1.29%	8.17%	NA
Indica III	913	18.00%	16.50%	4.38%	61.12%	NA
Indica Intermediate	786	31.20%	38.40%	1.78%	28.63%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.40%	0.00%	0.40%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	90.60%	0.00%	1.04%	8.33%	NA
Intermediate	90	77.80%	14.40%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121835877	C -> T	LOC_Os01g38900.1	downstream_gene_variant ; 1749.0bp to feature; MODIFIER	silent_mutation	Average:21.863; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0121835877	C -> T	LOC_Os01g38890-LOC_Os01g38900	intergenic_region ; MODIFIER	silent_mutation	Average:21.863; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0121835877	C -> DEL	N	N	silent_mutation	Average:21.863; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121835877	NA	2.02E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	2.65E-06	3.37E-06	mr1029	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	1.48E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	1.65E-06	1.73E-06	mr1047	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	6.98E-08	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	4.12E-06	4.28E-06	mr1189	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	6.26E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	3.38E-06	mr1471	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	7.42E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	9.13E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	7.82E-06	9.01E-06	mr1725	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	4.81E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	7.99E-07	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	4.48E-09	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	7.86E-06	8.82E-06	mr1796	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	1.05E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	5.98E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877	NA	1.69E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251