\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121835877:

Variant ID: vg0121835877 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21835877
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TGACTCCTATGTCCGATTCCCTTTCAGAAAAGAAAAAAAAGTCTGATTCTACATTGGTGAAAAAAATTGATGTGCCGAATTAAAGATCTGTTTGCAAAAA[C/T]
GAAACCTACATGTCGAGAGCATTCCATTTTTATATTATTTTAATTATTGGGTTTATACTTTTGCATTTGAGTCACTGTAATTTTTATATTTATATTTGAG

Reverse complement sequence

CTCAAATATAAATATAAAAATTACAGTGACTCAAATGCAAAAGTATAAACCCAATAATTAAAATAATATAAAAATGGAATGCTCTCGACATGTAGGTTTC[G/A]
TTTTTGCAAACAGATCTTTAATTCGGCACATCAATTTTTTTCACCAATGTAGAATCAGACTTTTTTTTCTTTTCTGAAAGGGAATCGGACATAGGAGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 27.80% 1.61% 21.03% NA
All Indica  2759 19.30% 47.10% 2.46% 31.10% NA
All Japonica  1512 99.60% 0.20% 0.00% 0.20% NA
Aus  269 53.50% 0.00% 2.23% 44.24% NA
Indica I  595 1.20% 91.30% 1.34% 6.22% NA
Indica II  465 25.20% 65.40% 1.29% 8.17% NA
Indica III  913 18.00% 16.50% 4.38% 61.12% NA
Indica Intermediate  786 31.20% 38.40% 1.78% 28.63% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 90.60% 0.00% 1.04% 8.33% NA
Intermediate  90 77.80% 14.40% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121835877 C -> T LOC_Os01g38900.1 downstream_gene_variant ; 1749.0bp to feature; MODIFIER silent_mutation Average:21.863; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0121835877 C -> T LOC_Os01g38890-LOC_Os01g38900 intergenic_region ; MODIFIER silent_mutation Average:21.863; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0121835877 C -> DEL N N silent_mutation Average:21.863; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121835877 NA 2.02E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 2.65E-06 3.37E-06 mr1029 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 1.48E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 1.65E-06 1.73E-06 mr1047 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 6.98E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 4.12E-06 4.28E-06 mr1189 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 6.26E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 3.38E-06 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 7.42E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 9.13E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 7.82E-06 9.01E-06 mr1725 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 4.81E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 7.99E-07 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 4.48E-09 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 7.86E-06 8.82E-06 mr1796 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 1.05E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 5.98E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121835877 NA 1.69E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251