\
| Variant ID: vg0121835801 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21835801 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATCTCTACTAGTTAAAAAATAAGATGCTTGCTTCGTCCGTCAAAAAAAATAGCGAAAAAATAAAATTAAAAAGTCTGACTCCTATGTCCGATTCCCTTT[C/T]
AGAAAAGAAAAAAAAGTCTGATTCTACATTGGTGAAAAAAATTGATGTGCCGAATTAAAGATCTGTTTGCAAAAACGAAACCTACATGTCGAGAGCATTC
GAATGCTCTCGACATGTAGGTTTCGTTTTTGCAAACAGATCTTTAATTCGGCACATCAATTTTTTTCACCAATGTAGAATCAGACTTTTTTTTCTTTTCT[G/A]
AAAGGGAATCGGACATAGGAGTCAGACTTTTTAATTTTATTTTTTCGCTATTTTTTTTGACGGACGAAGCAAGCATCTTATTTTTTAACTAGTAGAGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.80% | 26.50% | 1.31% | 23.42% | NA |
| All Indica | 2759 | 18.10% | 44.80% | 1.99% | 35.12% | NA |
| All Japonica | 1512 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Aus | 269 | 53.50% | 0.00% | 1.86% | 44.61% | NA |
| Indica I | 595 | 1.80% | 84.40% | 4.03% | 9.75% | NA |
| Indica II | 465 | 24.30% | 62.60% | 2.80% | 10.32% | NA |
| Indica III | 913 | 15.10% | 16.90% | 0.44% | 67.58% | NA |
| Indica Intermediate | 786 | 30.20% | 36.80% | 1.78% | 31.30% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 76.70% | 14.40% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121835801 | C -> T | LOC_Os01g38900.1 | downstream_gene_variant ; 1825.0bp to feature; MODIFIER | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0121835801 | C -> T | LOC_Os01g38890-LOC_Os01g38900 | intergenic_region ; MODIFIER | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0121835801 | C -> DEL | N | N | silent_mutation | Average:27.168; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121835801 | NA | 1.32E-07 | mr1029 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | 3.55E-06 | 5.49E-06 | mr1029 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 1.91E-10 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | 7.44E-06 | 8.72E-06 | mr1047 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 9.81E-08 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 1.74E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 7.62E-06 | mr1471 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 7.62E-07 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 3.86E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 9.85E-09 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 1.81E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 8.92E-16 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121835801 | NA | 3.90E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |