\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121803138:

Variant ID: vg0121803138 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21803138
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, C: 0.12, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GCTAGCGGCCAAAACGACGACAGGAGGTGACGCCGGCGATGGGAGGAAAAAGAAGAAAGGAAGAGGGAAAGGGGGCTTGCCTCCTTGCTTCTTTGGGAAA[C/A]
GAAAGAGGGAGAGAGGGCGACGCGGCAGAAGGAGGAGGAGCTCTGCCTCCGTCCCTTGGAAGCTAGCGCGCGGAGGTGGCGGGGCCGGGTCGTGACGACG

Reverse complement sequence

CGTCGTCACGACCCGGCCCCGCCACCTCCGCGCGCTAGCTTCCAAGGGACGGAGGCAGAGCTCCTCCTCCTTCTGCCGCGTCGCCCTCTCTCCCTCTTTC[G/T]
TTTCCCAAAGAAGCAAGGAGGCAAGCCCCCTTTCCCTCTTCCTTTCTTCTTTTTCCTCCCATCGCCGGCGTCACCTCCTGTCGTCGTTTTGGCCGCTAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 38.30% 0.30% 0.08% NA
All Indica  2759 95.40% 4.50% 0.14% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 70.60% 29.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 97.50% 2.10% 0.44% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 54.20% 9.38% 4.17% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121803138 C -> A LOC_Os01g38860.1 downstream_gene_variant ; 1674.0bp to feature; MODIFIER silent_mutation Average:67.798; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 N N N N
vg0121803138 C -> A LOC_Os01g38850-LOC_Os01g38860 intergenic_region ; MODIFIER silent_mutation Average:67.798; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 N N N N
vg0121803138 C -> DEL N N silent_mutation Average:67.798; most accessible tissue: Zhenshan97 flag leaf, score: 87.472 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0121803138 C A 0.0 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121803138 NA 2.90E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 9.28E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 6.79E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 5.58E-06 6.28E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 4.71E-06 NA mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 8.16E-38 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 3.70E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 1.32E-16 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 3.30E-39 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 9.10E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 4.36E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 5.03E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 3.90E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 5.82E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 3.84E-08 1.76E-17 mr1118_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 8.90E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 3.44E-07 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 3.81E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 1.22E-50 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 9.65E-08 NA mr1240_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 4.18E-09 2.72E-25 mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 6.99E-34 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 6.24E-07 1.29E-23 mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 1.57E-08 4.20E-14 mr1496_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 5.77E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 NA 2.24E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121803138 8.10E-06 NA mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251