\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121758038:

Variant ID: vg0121758038 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21758038
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


GATGATAAAATATGAATAGTACTTTATGTGCGACTAACTTTTTTTAATTTTCTCATAAATTTTTCAAATAAGACGGACGGTCAAACGTTGGACACGTATT[C/T]
CCACAACTGCACTTATTTTTGGGACGGAGATAGTACATGGTGTTTAAAAATCATCAAAAAATTAAAAAACTATTAAGATAGATTTTGTGCTATTGCTACA

Reverse complement sequence

TGTAGCAATAGCACAAAATCTATCTTAATAGTTTTTTAATTTTTTGATGATTTTTAAACACCATGTACTATCTCCGTCCCAAAAATAAGTGCAGTTGTGG[G/A]
AATACGTGTCCAACGTTTGACCGTCCGTCTTATTTGAAAAATTTATGAGAAAATTAAAAAAAGTTAGTCGCACATAAAGTACTATTCATATTTTATCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.50% 0.08% 0.17% NA
All Indica  2759 42.40% 57.20% 0.14% 0.29% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 8.10% 91.60% 0.34% 0.00% NA
Indica II  465 11.80% 88.00% 0.00% 0.22% NA
Indica III  913 75.70% 23.80% 0.22% 0.33% NA
Indica Intermediate  786 47.80% 51.70% 0.00% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121758038 C -> T LOC_Os01g38740.1 downstream_gene_variant ; 3590.0bp to feature; MODIFIER silent_mutation Average:39.712; most accessible tissue: Callus, score: 64.756 N N N N
vg0121758038 C -> T LOC_Os01g38750.1 downstream_gene_variant ; 2128.0bp to feature; MODIFIER silent_mutation Average:39.712; most accessible tissue: Callus, score: 64.756 N N N N
vg0121758038 C -> T LOC_Os01g38760.1 downstream_gene_variant ; 334.0bp to feature; MODIFIER silent_mutation Average:39.712; most accessible tissue: Callus, score: 64.756 N N N N
vg0121758038 C -> T LOC_Os01g38780.1 downstream_gene_variant ; 1896.0bp to feature; MODIFIER silent_mutation Average:39.712; most accessible tissue: Callus, score: 64.756 N N N N
vg0121758038 C -> T LOC_Os01g38790.1 downstream_gene_variant ; 4123.0bp to feature; MODIFIER silent_mutation Average:39.712; most accessible tissue: Callus, score: 64.756 N N N N
vg0121758038 C -> T LOC_Os01g38760-LOC_Os01g38780 intergenic_region ; MODIFIER silent_mutation Average:39.712; most accessible tissue: Callus, score: 64.756 N N N N
vg0121758038 C -> DEL N N silent_mutation Average:39.712; most accessible tissue: Callus, score: 64.756 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121758038 NA 1.27E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 2.89E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.66E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.59E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 9.17E-08 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.48E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 6.66E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.75E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.07E-06 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 5.50E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 2.28E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.03E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 6.03E-06 mr1220 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.16E-07 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 5.13E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 7.16E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 2.48E-17 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.72E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.99E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 2.72E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 6.72E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.16E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.22E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.10E-07 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 5.84E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 1.32E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 3.45E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 5.23E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 7.44E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121758038 NA 3.77E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251