\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121726963:

Variant ID: vg0121726963 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21726963
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, T: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAAGTCCGATCCCCCGAGCAAAAAAGTTCCGATCTCTTAAAAAGGGGAAAAAGACGGAGAGAAAATAGCGAAAAAAACAACTAACAAAAATAGTCC[G/A]
ATTCAAAAGTGGCAAAAAAAAAACAAAAAATAAAACCGTAGATCGTTTCCCATAAAAAAGGAAAAAAAAGTACGATATCTGTAAAAGGCGGAATAAAAAA

Reverse complement sequence

TTTTTTATTCCGCCTTTTACAGATATCGTACTTTTTTTTCCTTTTTTATGGGAAACGATCTACGGTTTTATTTTTTGTTTTTTTTTTGCCACTTTTGAAT[C/T]
GGACTATTTTTGTTAGTTGTTTTTTTCGCTATTTTCTCTCCGTCTTTTTCCCCTTTTTAAGAGATCGGAACTTTTTTGCTCGGGGGATCGGACTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 6.20% 11.11% 42.42% NA
All Indica  2759 6.60% 10.20% 15.40% 67.78% NA
All Japonica  1512 99.00% 0.10% 0.33% 0.60% NA
Aus  269 35.70% 3.30% 24.16% 36.80% NA
Indica I  595 2.90% 12.10% 10.92% 74.12% NA
Indica II  465 3.70% 17.00% 13.76% 65.59% NA
Indica III  913 6.60% 4.70% 18.40% 70.32% NA
Indica Intermediate  786 11.20% 11.20% 16.28% 61.32% NA
Temperate Japonica  767 99.10% 0.00% 0.26% 0.65% NA
Tropical Japonica  504 99.20% 0.20% 0.20% 0.40% NA
Japonica Intermediate  241 98.30% 0.00% 0.83% 0.83% NA
VI/Aromatic  96 71.90% 0.00% 20.83% 7.29% NA
Intermediate  90 63.30% 3.30% 11.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121726963 G -> A LOC_Os01g38680.1 upstream_gene_variant ; 1100.0bp to feature; MODIFIER silent_mutation Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0121726963 G -> A LOC_Os01g38690.1 upstream_gene_variant ; 3426.0bp to feature; MODIFIER silent_mutation Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0121726963 G -> A LOC_Os01g38670.1 downstream_gene_variant ; 4822.0bp to feature; MODIFIER silent_mutation Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0121726963 G -> A LOC_Os01g38680-LOC_Os01g38690 intergenic_region ; MODIFIER silent_mutation Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0121726963 G -> DEL N N silent_mutation Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121726963 NA 4.33E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121726963 6.08E-06 NA mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121726963 3.29E-06 8.31E-07 mr1380 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121726963 8.87E-06 NA mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121726963 5.30E-06 6.09E-08 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251