\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121628144:

Variant ID: vg0121628144 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21628144
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCTTTTACGCCGGATTAACATCAAGTCAAACCTTTGTCTACGATTTCCATTTTCTTTTACAACAAAGTACAAACGTGCACATATTCATCCATATGAAC[A/G]
CACATTCTTTTTTCTAAGGGAATGAACACACATCTTAACTCCTACGATTTTCATATATCTAATCTAAATATTTAAAAATATATAGATTTTTTTAAAAAAA

Reverse complement sequence

TTTTTTTAAAAAAATCTATATATTTTTAAATATTTAGATTAGATATATGAAAATCGTAGGAGTTAAGATGTGTGTTCATTCCCTTAGAAAAAAGAATGTG[T/C]
GTTCATATGGATGAATATGTGCACGTTTGTACTTTGTTGTAAAAGAAAATGGAAATCGTAGACAAAGGTTTGACTTGATGTTAATCCGGCGTAAAAGGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 39.50% 0.76% 2.14% NA
All Indica  2759 86.40% 9.80% 1.16% 2.57% NA
All Japonica  1512 4.30% 95.60% 0.07% 0.00% NA
Aus  269 79.20% 10.00% 0.37% 10.41% NA
Indica I  595 99.00% 0.70% 0.34% 0.00% NA
Indica II  465 74.40% 23.20% 0.00% 2.37% NA
Indica III  913 92.70% 4.60% 0.11% 2.63% NA
Indica Intermediate  786 76.80% 14.90% 3.69% 4.58% NA
Temperate Japonica  767 4.30% 95.60% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 31.10% 64.40% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121628144 A -> G LOC_Os01g38480.1 upstream_gene_variant ; 1377.0bp to feature; MODIFIER silent_mutation Average:88.88; most accessible tissue: Callus, score: 93.08 N N N N
vg0121628144 A -> G LOC_Os01g38490.1 upstream_gene_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:88.88; most accessible tissue: Callus, score: 93.08 N N N N
vg0121628144 A -> G LOC_Os01g38510.1 upstream_gene_variant ; 4263.0bp to feature; MODIFIER silent_mutation Average:88.88; most accessible tissue: Callus, score: 93.08 N N N N
vg0121628144 A -> G LOC_Os01g38480.2 upstream_gene_variant ; 1377.0bp to feature; MODIFIER silent_mutation Average:88.88; most accessible tissue: Callus, score: 93.08 N N N N
vg0121628144 A -> G LOC_Os01g38480.3 upstream_gene_variant ; 1377.0bp to feature; MODIFIER silent_mutation Average:88.88; most accessible tissue: Callus, score: 93.08 N N N N
vg0121628144 A -> G LOC_Os01g38500.1 downstream_gene_variant ; 547.0bp to feature; MODIFIER silent_mutation Average:88.88; most accessible tissue: Callus, score: 93.08 N N N N
vg0121628144 A -> G LOC_Os01g38490-LOC_Os01g38500 intergenic_region ; MODIFIER silent_mutation Average:88.88; most accessible tissue: Callus, score: 93.08 N N N N
vg0121628144 A -> DEL N N silent_mutation Average:88.88; most accessible tissue: Callus, score: 93.08 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0121628144 A G -0.02 -0.04 -0.03 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121628144 NA 3.26E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 8.29E-32 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 5.39E-29 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 1.32E-14 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 8.55E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 1.07E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 6.56E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 8.98E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 6.97E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 4.38E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 2.36E-08 3.04E-29 mr1698 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 1.43E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 1.83E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 4.35E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 7.12E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 5.13E-21 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 3.59E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 3.75E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 4.15E-28 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 2.92E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 5.41E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 9.76E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 6.62E-21 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 2.14E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 5.57E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 8.92E-07 8.32E-25 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 6.63E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121628144 NA 2.45E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251