Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0121624043:

Variant ID: vg0121624043 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21624043
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

ATACCCCAGATGCCGCTGGATCTAGACATATTTAGTCTTCCCACGACTCTCCTGCTTCTTCACCTGTAATCATGCACAGAGATATCAACAATTGAAGTGC[A/G]
CAGTTCCAGCAATCATCTTGACTATTGACTACATGTTTGCAATTGAATGATAGGTGCTTGCTTACTTACCACTCTGAATTCTGACCGCAGCTTGCCCACA

Reverse complement sequence

TGTGGGCAAGCTGCGGTCAGAATTCAGAGTGGTAAGTAAGCAAGCACCTATCATTCAATTGCAAACATGTAGTCAATAGTCAAGATGATTGCTGGAACTG[T/C]
GCACTTCAATTGTTGATATCTCTGTGCATGATTACAGGTGAAGAAGCAGGAGAGTCGTGGGAAGACTAAATATGTCTAGATCCAGCGGCATCTGGGGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	46.40%	0.13%	0.00%	NA
All Indica	2759	84.20%	15.60%	0.22%	0.00%	NA
All Japonica	1512	1.10%	98.90%	0.00%	0.00%	NA
Aus	269	48.30%	51.70%	0.00%	0.00%	NA
Indica I	595	97.60%	2.20%	0.17%	0.00%	NA
Indica II	465	73.10%	26.20%	0.65%	0.00%	NA
Indica III	913	91.30%	8.70%	0.00%	0.00%	NA
Indica Intermediate	786	72.10%	27.60%	0.25%	0.00%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	68.80%	0.00%	0.00%	NA
Intermediate	90	30.00%	70.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121624043	A -> G	LOC_Os01g38490.1	downstream_gene_variant ; 3111.0bp to feature; MODIFIER	silent_mutation	Average:66.11; most accessible tissue: Callus, score: 90.991	N	N	N	N
vg0121624043	A -> G	LOC_Os01g38500.1	downstream_gene_variant ; 4648.0bp to feature; MODIFIER	silent_mutation	Average:66.11; most accessible tissue: Callus, score: 90.991	N	N	N	N
vg0121624043	A -> G	LOC_Os01g38480.1	intron_variant ; MODIFIER	silent_mutation	Average:66.11; most accessible tissue: Callus, score: 90.991	N	N	N	N
vg0121624043	A -> G	LOC_Os01g38480.2	intron_variant ; MODIFIER	silent_mutation	Average:66.11; most accessible tissue: Callus, score: 90.991	N	N	N	N
vg0121624043	A -> G	LOC_Os01g38480.3	intron_variant ; MODIFIER	silent_mutation	Average:66.11; most accessible tissue: Callus, score: 90.991	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121624043	NA	8.29E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121624043	NA	4.61E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121624043	NA	2.86E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121624043	2.48E-06	1.69E-22	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121624043	2.17E-06	1.13E-06	mr1698	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121624043	NA	6.50E-08	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121624043	NA	3.96E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121624043	NA	3.69E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121624043	NA	1.37E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251