\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121623910:

Variant ID: vg0121623910 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21623910
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.29, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCTAACATGTCGCCAAATCCATTGGCATCCCACAGCATCAGCAAAAGGATGTTCCCGAGTTTTGTTCACACATACGAGAGAAAGGTCTCATTTTATAA[T/C]
ACGCTTTATACATTCCCAGCTTGTATGATTGAATACCCCAGATGCCGCTGGATCTAGACATATTTAGTCTTCCCACGACTCTCCTGCTTCTTCACCTGTA

Reverse complement sequence

TACAGGTGAAGAAGCAGGAGAGTCGTGGGAAGACTAAATATGTCTAGATCCAGCGGCATCTGGGGTATTCAATCATACAAGCTGGGAATGTATAAAGCGT[A/G]
TTATAAAATGAGACCTTTCTCTCGTATGTGTGAACAAAACTCGGGAACATCCTTTTGCTGATGCTGTGGGATGCCAATGGATTTGGCGACATGTTAGGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 10.90% 0.99% 53.58% NA
All Indica  2759 2.50% 12.20% 1.67% 83.62% NA
All Japonica  1512 95.60% 3.20% 0.00% 1.19% NA
Aus  269 1.10% 42.80% 0.37% 55.76% NA
Indica I  595 1.70% 2.40% 1.85% 94.12% NA
Indica II  465 3.00% 24.10% 1.29% 71.61% NA
Indica III  913 1.40% 8.30% 1.10% 89.16% NA
Indica Intermediate  786 4.10% 17.20% 2.42% 76.34% NA
Temperate Japonica  767 95.60% 3.30% 0.00% 1.17% NA
Tropical Japonica  504 97.60% 1.60% 0.00% 0.79% NA
Japonica Intermediate  241 91.70% 6.20% 0.00% 2.07% NA
VI/Aromatic  96 68.80% 1.00% 0.00% 30.21% NA
Intermediate  90 55.60% 13.30% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121623910 T -> DEL N N silent_mutation Average:59.526; most accessible tissue: Callus, score: 79.176 N N N N
vg0121623910 T -> C LOC_Os01g38480.1 3_prime_UTR_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:59.526; most accessible tissue: Callus, score: 79.176 N N N N
vg0121623910 T -> C LOC_Os01g38480.2 3_prime_UTR_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:59.526; most accessible tissue: Callus, score: 79.176 N N N N
vg0121623910 T -> C LOC_Os01g38480.3 3_prime_UTR_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:59.526; most accessible tissue: Callus, score: 79.176 N N N N
vg0121623910 T -> C LOC_Os01g38490.1 downstream_gene_variant ; 3244.0bp to feature; MODIFIER silent_mutation Average:59.526; most accessible tissue: Callus, score: 79.176 N N N N
vg0121623910 T -> C LOC_Os01g38500.1 downstream_gene_variant ; 4781.0bp to feature; MODIFIER silent_mutation Average:59.526; most accessible tissue: Callus, score: 79.176 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121623910 NA 4.77E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 3.75E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 2.38E-17 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 5.00E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 2.08E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 6.76E-09 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 7.55E-06 7.55E-06 mr1190 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 7.55E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 8.17E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 1.69E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 1.31E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 4.44E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 1.02E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 1.04E-07 mr1439 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 3.50E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 6.56E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 2.40E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 1.66E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 5.53E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 1.65E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 1.13E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 3.19E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 6.11E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 1.64E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 7.78E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910 NA 5.92E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251