Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121623910:

Variant ID: vg0121623910 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21623910
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.29, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

TGCCTAACATGTCGCCAAATCCATTGGCATCCCACAGCATCAGCAAAAGGATGTTCCCGAGTTTTGTTCACACATACGAGAGAAAGGTCTCATTTTATAA[T/C]
ACGCTTTATACATTCCCAGCTTGTATGATTGAATACCCCAGATGCCGCTGGATCTAGACATATTTAGTCTTCCCACGACTCTCCTGCTTCTTCACCTGTA

Reverse complement sequence

TACAGGTGAAGAAGCAGGAGAGTCGTGGGAAGACTAAATATGTCTAGATCCAGCGGCATCTGGGGTATTCAATCATACAAGCTGGGAATGTATAAAGCGT[A/G]
TTATAAAATGAGACCTTTCTCTCGTATGTGTGAACAAAACTCGGGAACATCCTTTTGCTGATGCTGTGGGATGCCAATGGATTTGGCGACATGTTAGGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.60%	10.90%	0.99%	53.58%	NA
All Indica	2759	2.50%	12.20%	1.67%	83.62%	NA
All Japonica	1512	95.60%	3.20%	0.00%	1.19%	NA
Aus	269	1.10%	42.80%	0.37%	55.76%	NA
Indica I	595	1.70%	2.40%	1.85%	94.12%	NA
Indica II	465	3.00%	24.10%	1.29%	71.61%	NA
Indica III	913	1.40%	8.30%	1.10%	89.16%	NA
Indica Intermediate	786	4.10%	17.20%	2.42%	76.34%	NA
Temperate Japonica	767	95.60%	3.30%	0.00%	1.17%	NA
Tropical Japonica	504	97.60%	1.60%	0.00%	0.79%	NA
Japonica Intermediate	241	91.70%	6.20%	0.00%	2.07%	NA
VI/Aromatic	96	68.80%	1.00%	0.00%	30.21%	NA
Intermediate	90	55.60%	13.30%	0.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121623910	T -> DEL	N	N	silent_mutation	Average:59.526; most accessible tissue: Callus, score: 79.176	N	N	N	N
vg0121623910	T -> C	LOC_Os01g38480.1	3_prime_UTR_variant ; 54.0bp to feature; MODIFIER	silent_mutation	Average:59.526; most accessible tissue: Callus, score: 79.176	N	N	N	N
vg0121623910	T -> C	LOC_Os01g38480.2	3_prime_UTR_variant ; 54.0bp to feature; MODIFIER	silent_mutation	Average:59.526; most accessible tissue: Callus, score: 79.176	N	N	N	N
vg0121623910	T -> C	LOC_Os01g38480.3	3_prime_UTR_variant ; 235.0bp to feature; MODIFIER	silent_mutation	Average:59.526; most accessible tissue: Callus, score: 79.176	N	N	N	N
vg0121623910	T -> C	LOC_Os01g38490.1	downstream_gene_variant ; 3244.0bp to feature; MODIFIER	silent_mutation	Average:59.526; most accessible tissue: Callus, score: 79.176	N	N	N	N
vg0121623910	T -> C	LOC_Os01g38500.1	downstream_gene_variant ; 4781.0bp to feature; MODIFIER	silent_mutation	Average:59.526; most accessible tissue: Callus, score: 79.176	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121623910	NA	4.77E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	3.75E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	2.38E-17	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	5.00E-23	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	2.08E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	6.76E-09	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	7.55E-06	7.55E-06	mr1190	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	7.55E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	8.17E-14	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	1.69E-18	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	1.31E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	4.44E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	1.02E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	1.04E-07	mr1439	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	3.50E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	6.56E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	2.40E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	1.66E-12	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	5.53E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	1.65E-12	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	1.13E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	3.19E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	6.11E-21	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	1.64E-08	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	7.78E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121623910	NA	5.92E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251