\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121587946:

Variant ID: vg0121587946 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21587946
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGATGTCATTCTTGGGATGGATTGGCTGACCAAGTTCAAGGGAGTTATTGATTGTGCGAATCGCACAGTCACCTTGACCAATGAGAAGGGAGAAACAATA[G/A]
TGTACAAATCATCAGTCTCACCAAAGCAAGGGGTCTCCTTGAATCAGATTGAGGTGGAAATTCCAGTGGTCACCGAGGGGAAGAGTTCGACGAAATTGGA

Reverse complement sequence

TCCAATTTCGTCGAACTCTTCCCCTCGGTGACCACTGGAATTTCCACCTCAATCTGATTCAAGGAGACCCCTTGCTTTGGTGAGACTGATGATTTGTACA[C/T]
TATTGTTTCTCCCTTCTCATTGGTCAAGGTGACTGTGCGATTCGCACAATCAATAACTCCCTTGAACTTGGTCAGCCAATCCATCCCAAGAATGACATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 20.10% 1.88% 2.39% NA
All Indica  2759 66.30% 32.00% 1.23% 0.47% NA
All Japonica  1512 97.10% 0.40% 0.79% 1.72% NA
Aus  269 49.80% 17.80% 11.90% 20.45% NA
Indica I  595 89.40% 9.70% 0.84% 0.00% NA
Indica II  465 85.60% 14.20% 0.22% 0.00% NA
Indica III  913 40.20% 57.80% 1.64% 0.33% NA
Indica Intermediate  786 67.60% 29.50% 1.65% 1.27% NA
Temperate Japonica  767 97.10% 0.00% 1.30% 1.56% NA
Tropical Japonica  504 98.60% 1.20% 0.00% 0.20% NA
Japonica Intermediate  241 93.80% 0.00% 0.83% 5.39% NA
VI/Aromatic  96 74.00% 1.00% 10.42% 14.58% NA
Intermediate  90 82.20% 11.10% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121587946 G -> A LOC_Os01g38420.1 missense_variant ; p.Val139Met; MODERATE nonsynonymous_codon ; V139M Average:28.67; most accessible tissue: Minghui63 flag leaf, score: 57.881 probably damaging 2.683 DELETERIOUS 0.00
vg0121587946 G -> DEL LOC_Os01g38420.1 N frameshift_variant Average:28.67; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121587946 NA 1.06E-10 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 5.37E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 2.89E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 3.37E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 9.07E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 2.32E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 1.45E-08 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 3.88E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 1.53E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 3.27E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 2.38E-06 NA mr1583 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 1.81E-10 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 4.72E-12 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 1.26E-10 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 8.57E-12 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 2.55E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 9.28E-13 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 2.17E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 3.01E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 4.53E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 1.33E-12 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 2.42E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 3.08E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121587946 NA 2.32E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251