\
| Variant ID: vg0121578906 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21578906 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.04, others allele: 0.00, population size: 28. )
ACCGTGTGTACACTGTACTGGTGCACACGCATGTGCTGTATATGCAGGGCTTGTATTCCGATCCATGTAGGTTGTCACACCCTGAAGTTTTTCCCCCAAG[C/T]
CTAAATTGAATTTATAAATCACCTTGAGAAAATACCAGACTCAAAGCAAGAGAACCCTAATAAAGTAATGCAAATAATAATCGGAATTGGCATGTGGGAT
ATCCCACATGCCAATTCCGATTATTATTTGCATTACTTTATTAGGGTTCTCTTGCTTTGAGTCTGGTATTTTCTCAAGGTGATTTATAAATTCAATTTAG[G/A]
CTTGGGGGAAAAACTTCAGGGTGTGACAACCTACATGGATCGGAATACAAGCCCTGCATATACAGCACATGCGTGTGCACCAGTACAGTGTACACACGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.70% | 8.80% | 16.46% | 49.05% | NA |
| All Indica | 2759 | 3.00% | 0.50% | 23.92% | 72.60% | NA |
| All Japonica | 1512 | 67.40% | 25.60% | 3.44% | 3.57% | NA |
| Aus | 269 | 4.80% | 0.00% | 20.07% | 75.09% | NA |
| Indica I | 595 | 0.80% | 0.00% | 11.43% | 87.73% | NA |
| Indica II | 465 | 3.70% | 0.60% | 18.71% | 76.99% | NA |
| Indica III | 913 | 2.00% | 0.30% | 35.05% | 62.65% | NA |
| Indica Intermediate | 786 | 5.50% | 0.90% | 23.54% | 70.10% | NA |
| Temperate Japonica | 767 | 92.30% | 2.30% | 1.83% | 3.52% | NA |
| Tropical Japonica | 504 | 26.40% | 65.90% | 5.75% | 1.98% | NA |
| Japonica Intermediate | 241 | 73.90% | 15.40% | 3.73% | 7.05% | NA |
| VI/Aromatic | 96 | 68.80% | 0.00% | 3.12% | 28.12% | NA |
| Intermediate | 90 | 37.80% | 16.70% | 10.00% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121578906 | C -> T | LOC_Os01g38400-LOC_Os01g38410 | intergenic_region ; MODIFIER | silent_mutation | Average:14.531; most accessible tissue: Callus, score: 54.079 | N | N | N | N |
| vg0121578906 | C -> DEL | N | N | silent_mutation | Average:14.531; most accessible tissue: Callus, score: 54.079 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121578906 | NA | 4.42E-09 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 1.19E-10 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 3.85E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 9.89E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 2.44E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 1.89E-09 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | 5.00E-08 | 1.04E-42 | mr1699 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | 8.75E-06 | 1.95E-22 | mr1699 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 4.04E-21 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 5.04E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 2.57E-11 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 4.37E-15 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 1.73E-06 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 5.54E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 1.77E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 1.29E-36 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 1.06E-18 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121578906 | NA | 1.08E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |