| Variant ID: vg0121574351 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21574351 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATCACCTAAGAAAAAGCACAATGATCAAGAACAGTGCTAAACCTTCTTTATTCTATAAATAATTCTCATTTGTTGAAGTAATAGGTTGCTTTGTATCAC[G/T]
TGGATTGTATCAAGTTTTAAATATTCCAAGTTTTAAATATTCCATGCAGTTGTACCAATAAAAATTAATCTTGATTGGTTGCATGCAGCGCATTCAATGA
TCATTGAATGCGCTGCATGCAACCAATCAAGATTAATTTTTATTGGTACAACTGCATGGAATATTTAAAACTTGGAATATTTAAAACTTGATACAATCCA[C/A]
GTGATACAAAGCAACCTATTACTTCAACAAATGAGAATTATTTATAGAATAAAGAAGGTTTAGCACTGTTCTTGATCATTGTGCTTTTTCTTAGGTGATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.10% | 1.10% | 29.12% | 26.62% | NA |
| All Indica | 2759 | 17.70% | 0.00% | 44.65% | 37.62% | NA |
| All Japonica | 1512 | 91.70% | 3.10% | 3.51% | 1.65% | NA |
| Aus | 269 | 14.50% | 0.00% | 25.65% | 59.85% | NA |
| Indica I | 595 | 29.40% | 0.00% | 31.93% | 38.66% | NA |
| Indica II | 465 | 17.80% | 0.00% | 39.78% | 42.37% | NA |
| Indica III | 913 | 6.70% | 0.00% | 57.83% | 35.49% | NA |
| Indica Intermediate | 786 | 21.60% | 0.00% | 41.86% | 36.51% | NA |
| Temperate Japonica | 767 | 87.90% | 5.70% | 5.08% | 1.30% | NA |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.79% | 1.59% | NA |
| Japonica Intermediate | 241 | 91.70% | 1.20% | 4.15% | 2.90% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 12.50% | 16.67% | NA |
| Intermediate | 90 | 62.20% | 6.70% | 11.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121574351 | G -> T | LOC_Os01g38400.1 | downstream_gene_variant ; 3228.0bp to feature; MODIFIER | silent_mutation | Average:8.388; most accessible tissue: Callus, score: 37.564 | N | N | N | N |
| vg0121574351 | G -> T | LOC_Os01g38400-LOC_Os01g38410 | intergenic_region ; MODIFIER | silent_mutation | Average:8.388; most accessible tissue: Callus, score: 37.564 | N | N | N | N |
| vg0121574351 | G -> DEL | N | N | silent_mutation | Average:8.388; most accessible tissue: Callus, score: 37.564 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121574351 | 4.52E-06 | 4.52E-06 | mr1098 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121574351 | 3.28E-07 | NA | mr1101 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121574351 | 5.06E-06 | NA | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121574351 | 6.75E-08 | 1.93E-07 | mr1150 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121574351 | 7.15E-07 | 4.92E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121574351 | 7.84E-07 | 3.12E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121574351 | NA | 1.61E-06 | mr1961_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |