\
| Variant ID: vg0121492519 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21492519 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGTTACAATCTTTACAGAGTTTTTTCATTTTCTCTTGTTTCTTCCTGTAAATATTACCTGTAATTATTCCTTCAATAAATGAAAATCACACTGCTGGGC[T/A]
AATACCTGGCAGTACTTTCAGTCAAAAAAATAATTATAGAAATTCATTTAAATGCCTCAAAAACTTCTAAAATTCATATATAATTCATTCGAACTCCGAA
TTCGGAGTTCGAATGAATTATATATGAATTTTAGAAGTTTTTGAGGCATTTAAATGAATTTCTATAATTATTTTTTTGACTGAAAGTACTGCCAGGTATT[A/T]
GCCCAGCAGTGTGATTTTCATTTATTGAAGGAATAATTACAGGTAATATTTACAGGAAGAAACAAGAGAAAATGAAAAAACTCTGTAAAGATTGTAACCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.20% | 0.70% | 0.55% | 53.51% | NA |
| All Indica | 2759 | 18.10% | 1.20% | 0.87% | 79.81% | NA |
| All Japonica | 1512 | 97.60% | 0.00% | 0.07% | 2.38% | NA |
| Aus | 269 | 13.00% | 0.00% | 0.37% | 86.62% | NA |
| Indica I | 595 | 36.30% | 0.20% | 0.84% | 62.69% | NA |
| Indica II | 465 | 20.20% | 1.10% | 0.65% | 78.06% | NA |
| Indica III | 913 | 3.30% | 1.50% | 0.88% | 94.30% | NA |
| Indica Intermediate | 786 | 20.20% | 1.80% | 1.02% | 76.97% | NA |
| Temperate Japonica | 767 | 98.40% | 0.00% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 69.80% | 0.00% | 0.00% | 30.21% | NA |
| Intermediate | 90 | 67.80% | 0.00% | 0.00% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121492519 | T -> A | LOC_Os01g38310.1 | upstream_gene_variant ; 4049.0bp to feature; MODIFIER | silent_mutation | Average:10.886; most accessible tissue: Callus, score: 49.648 | N | N | N | N |
| vg0121492519 | T -> A | LOC_Os01g38320.1 | upstream_gene_variant ; 1742.0bp to feature; MODIFIER | silent_mutation | Average:10.886; most accessible tissue: Callus, score: 49.648 | N | N | N | N |
| vg0121492519 | T -> A | LOC_Os01g38310-LOC_Os01g38320 | intergenic_region ; MODIFIER | silent_mutation | Average:10.886; most accessible tissue: Callus, score: 49.648 | N | N | N | N |
| vg0121492519 | T -> DEL | N | N | silent_mutation | Average:10.886; most accessible tissue: Callus, score: 49.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121492519 | NA | 8.74E-14 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121492519 | NA | 6.83E-06 | mr1661 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121492519 | NA | 3.17E-09 | mr1836 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |