\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121481145:

Variant ID: vg0121481145 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21481145
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTCCTTCAGCCCAATATTTTCAACAGTGTGGCCTGTTGTGATCCCTAGGGACTTAGGCATTCTTTTGCTTTGGCAATTTGTGCTCACAATGGTCTGGC[C/T]
CGATACTGTCAAAATCATTTTTCTCGCGGTTAGATAATTCTTTGGAATTACTACGATGCAAATAAAAAGTTGCCCGACAGGAGTGTTATACTACTTTTTG

Reverse complement sequence

CAAAAAGTAGTATAACACTCCTGTCGGGCAACTTTTTATTTGCATCGTAGTAATTCCAAAGAATTATCTAACCGCGAGAAAAATGATTTTGACAGTATCG[G/A]
GCCAGACCATTGTGAGCACAAATTGCCAAAGCAAAAGAATGCCTAAGTCCCTAGGGATCACAACAGGCCACACTGTTGAAAATATTGGGCTGAAGGACTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 6.90% 0.28% 3.26% NA
All Indica  2759 92.40% 2.10% 0.40% 5.07% NA
All Japonica  1512 99.30% 0.20% 0.00% 0.53% NA
Aus  269 7.80% 91.80% 0.00% 0.37% NA
Indica I  595 98.70% 0.80% 0.17% 0.34% NA
Indica II  465 98.30% 0.40% 0.00% 1.29% NA
Indica III  913 86.90% 1.60% 0.55% 10.95% NA
Indica Intermediate  786 90.60% 4.70% 0.64% 4.07% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 99.00% 0.40% 0.00% 0.60% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 13.50% 2.08% 2.08% NA
Intermediate  90 90.00% 6.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121481145 C -> T LOC_Os01g38300.1 upstream_gene_variant ; 364.0bp to feature; MODIFIER silent_mutation Average:27.418; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0121481145 C -> T LOC_Os01g38300-LOC_Os01g38310 intergenic_region ; MODIFIER silent_mutation Average:27.418; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N
vg0121481145 C -> DEL N N silent_mutation Average:27.418; most accessible tissue: Zhenshan97 root, score: 44.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121481145 NA 6.89E-22 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 5.35E-30 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 1.90E-26 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 6.46E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 1.55E-25 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 2.68E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 2.95E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 2.24E-18 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 2.03E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 8.13E-22 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 2.04E-30 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 2.47E-23 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 6.26E-07 NA mr1404_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 7.21E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 2.91E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121481145 NA 3.47E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251