\
| Variant ID: vg0121481145 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21481145 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAGTCCTTCAGCCCAATATTTTCAACAGTGTGGCCTGTTGTGATCCCTAGGGACTTAGGCATTCTTTTGCTTTGGCAATTTGTGCTCACAATGGTCTGGC[C/T]
CGATACTGTCAAAATCATTTTTCTCGCGGTTAGATAATTCTTTGGAATTACTACGATGCAAATAAAAAGTTGCCCGACAGGAGTGTTATACTACTTTTTG
CAAAAAGTAGTATAACACTCCTGTCGGGCAACTTTTTATTTGCATCGTAGTAATTCCAAAGAATTATCTAACCGCGAGAAAAATGATTTTGACAGTATCG[G/A]
GCCAGACCATTGTGAGCACAAATTGCCAAAGCAAAAGAATGCCTAAGTCCCTAGGGATCACAACAGGCCACACTGTTGAAAATATTGGGCTGAAGGACTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 6.90% | 0.28% | 3.26% | NA |
| All Indica | 2759 | 92.40% | 2.10% | 0.40% | 5.07% | NA |
| All Japonica | 1512 | 99.30% | 0.20% | 0.00% | 0.53% | NA |
| Aus | 269 | 7.80% | 91.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 98.70% | 0.80% | 0.17% | 0.34% | NA |
| Indica II | 465 | 98.30% | 0.40% | 0.00% | 1.29% | NA |
| Indica III | 913 | 86.90% | 1.60% | 0.55% | 10.95% | NA |
| Indica Intermediate | 786 | 90.60% | 4.70% | 0.64% | 4.07% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 99.00% | 0.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 13.50% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121481145 | C -> T | LOC_Os01g38300.1 | upstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:27.418; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg0121481145 | C -> T | LOC_Os01g38300-LOC_Os01g38310 | intergenic_region ; MODIFIER | silent_mutation | Average:27.418; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| vg0121481145 | C -> DEL | N | N | silent_mutation | Average:27.418; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121481145 | NA | 6.89E-22 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 5.35E-30 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 1.90E-26 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 6.46E-24 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 1.55E-25 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 2.68E-06 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 2.95E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 2.24E-18 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 2.03E-12 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 8.13E-22 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 2.04E-30 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 2.47E-23 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | 6.26E-07 | NA | mr1404_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 7.21E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 2.91E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121481145 | NA | 3.47E-13 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |