\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121412555:

Variant ID: vg0121412555 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21412555
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGCTGAGAGACACCGCAAAAATGTGTATTTGCTATAAGACATCTTTAAAAACTGGTAATTAGCTGCTGGACACCCGCGGTATTATTTTATTATTTTCA[G/A]
AGGAATAGGAGAGAGAAACCATGTTTAAAAACAAGTTTGCCCTTGGCTCAAATGAATCCAACGTGGGCCCCACATGTGACCTTAAATGTAAGCCCCTCTC

Reverse complement sequence

GAGAGGGGCTTACATTTAAGGTCACATGTGGGGCCCACGTTGGATTCATTTGAGCCAAGGGCAAACTTGTTTTTAAACATGGTTTCTCTCTCCTATTCCT[C/T]
TGAAAATAATAAAATAATACCGCGGGTGTCCAGCAGCTAATTACCAGTTTTTAAAGATGTCTTATAGCAAATACACATTTTTGCGGTGTCTCTCAGCTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 1.10% 1.84% 62.93% NA
All Indica  2759 4.80% 0.00% 1.05% 94.13% NA
All Japonica  1512 89.40% 3.20% 3.37% 4.03% NA
Aus  269 5.60% 0.00% 1.86% 92.57% NA
Indica I  595 4.00% 0.00% 0.84% 95.13% NA
Indica II  465 7.30% 0.00% 1.08% 91.61% NA
Indica III  913 2.20% 0.00% 0.66% 97.15% NA
Indica Intermediate  786 7.00% 0.00% 1.65% 91.35% NA
Temperate Japonica  767 84.40% 6.00% 5.74% 3.91% NA
Tropical Japonica  504 97.00% 0.00% 0.60% 2.38% NA
Japonica Intermediate  241 89.60% 0.80% 1.66% 7.88% NA
VI/Aromatic  96 68.80% 0.00% 1.04% 30.21% NA
Intermediate  90 50.00% 6.70% 1.11% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121412555 G -> A LOC_Os01g38229.1 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:13.309; most accessible tissue: Callus, score: 86.581 N N N N
vg0121412555 G -> A LOC_Os01g38229.4 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:13.309; most accessible tissue: Callus, score: 86.581 N N N N
vg0121412555 G -> A LOC_Os01g38229.3 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:13.309; most accessible tissue: Callus, score: 86.581 N N N N
vg0121412555 G -> A LOC_Os01g38229.2 upstream_gene_variant ; 2514.0bp to feature; MODIFIER silent_mutation Average:13.309; most accessible tissue: Callus, score: 86.581 N N N N
vg0121412555 G -> A LOC_Os01g38200-LOC_Os01g38229 intergenic_region ; MODIFIER silent_mutation Average:13.309; most accessible tissue: Callus, score: 86.581 N N N N
vg0121412555 G -> DEL N N silent_mutation Average:13.309; most accessible tissue: Callus, score: 86.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121412555 3.03E-06 NA mr1124 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121412555 1.05E-06 2.28E-06 mr1134 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121412555 1.55E-06 NA mr1149 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121412555 2.15E-06 NA mr1202 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251