\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121235022:

Variant ID: vg0121235022 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21235022
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTATCATCTTCCGTTTTATACCCTGTTCATGTTCAGAGTCCAGATATTCAGTGTAGCTAGTGATCTGTTGGACTTGGACGTAAACCGCGAGATTCCAA[C/T]
AATCAGAAACTGCACATATCAATTTGTCGCGTTCTTTTGATGTAACTGCTTTTTTTTTTCTTTTGGGCCTTTCTAGTTGTAAAGTGGAGTAATGTGTAAA

Reverse complement sequence

TTTACACATTACTCCACTTTACAACTAGAAAGGCCCAAAAGAAAAAAAAAAGCAGTTACATCAAAAGAACGCGACAAATTGATATGTGCAGTTTCTGATT[G/A]
TTGGAATCTCGCGGTTTACGTCCAAGTCCAACAGATCACTAGCTACACTGAATATCTGGACTCTGAACATGAACAGGGTATAAAACGGAAGATGATAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 6.30% 0.00% 0.00% NA
All Indica  2759 95.00% 5.00% 0.00% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 95.60% 4.40% 0.00% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121235022 C -> T LOC_Os01g37910.1 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:88.908; most accessible tissue: Zhenshan97 young leaf, score: 96.811 N N N N
vg0121235022 C -> T LOC_Os01g37910.3 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:88.908; most accessible tissue: Zhenshan97 young leaf, score: 96.811 N N N N
vg0121235022 C -> T LOC_Os01g37910.2 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:88.908; most accessible tissue: Zhenshan97 young leaf, score: 96.811 N N N N
vg0121235022 C -> T LOC_Os01g37910-LOC_Os01g37920 intergenic_region ; MODIFIER silent_mutation Average:88.908; most accessible tissue: Zhenshan97 young leaf, score: 96.811 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0121235022 C T -0.02 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121235022 NA 3.94E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121235022 NA 5.82E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121235022 NA 1.01E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121235022 NA 1.89E-07 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121235022 NA 6.50E-11 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121235022 NA 2.46E-10 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121235022 NA 6.66E-14 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121235022 NA 2.77E-19 mr1927_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251