\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121174382:

Variant ID: vg0121174382 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21174382
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TACAAAACTTATAATATATAAGAAATTATGAGTCAAAAATTAGTTTTAGAGACCATACCATGTTTGACCATGTCTAATATTATGGGATAGAGGAAGTACT[G/A,C]
TTACCTTCATCCCAAAATATAAAACCCAAGTATAAGATAGAACATTTTCTAGTACTACGAATCTGGACAGCCTAAGAAATGTCCCATACGGTATTATGGT

Reverse complement sequence

ACCATAATACCGTATGGGACATTTCTTAGGCTGTCCAGATTCGTAGTACTAGAAAATGTTCTATCTTATACTTGGGTTTTATATTTTGGGATGAAGGTAA[C/T,G]
AGTACTTCCTCTATCCCATAATATTAGACATGGTCAAACATGGTATGGTCTCTAAAACTAATTTTTGACTCATAATTTCTTATATATTATAAGTTTTGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 13.90% 0.17% 0.00% C: 0.30%
All Indica  2759 82.60% 16.70% 0.22% 0.00% C: 0.51%
All Japonica  1512 98.30% 1.70% 0.07% 0.00% NA
Aus  269 43.90% 56.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 67.10% 32.70% 0.22% 0.00% NA
Indica III  913 86.50% 11.80% 0.33% 0.00% C: 1.31%
Indica Intermediate  786 74.30% 25.20% 0.25% 0.00% C: 0.25%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.00% 0.20% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121174382 G -> A LOC_Os01g37837.1 upstream_gene_variant ; 1362.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> A LOC_Os01g37837.3 upstream_gene_variant ; 1362.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> A LOC_Os01g37837.2 upstream_gene_variant ; 1362.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> A LOC_Os01g37832.1 downstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> A LOC_Os01g37832.2 downstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> A LOC_Os01g37832.3 downstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> A LOC_Os01g37832-LOC_Os01g37837 intergenic_region ; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> C LOC_Os01g37837.1 upstream_gene_variant ; 1362.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> C LOC_Os01g37837.3 upstream_gene_variant ; 1362.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> C LOC_Os01g37837.2 upstream_gene_variant ; 1362.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> C LOC_Os01g37832.1 downstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> C LOC_Os01g37832.2 downstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> C LOC_Os01g37832.3 downstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0121174382 G -> C LOC_Os01g37832-LOC_Os01g37837 intergenic_region ; MODIFIER silent_mutation Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121174382 NA 2.10E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 1.84E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 8.89E-07 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 1.11E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 2.80E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 4.93E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 1.02E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 2.49E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 6.04E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 3.18E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 2.28E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 8.19E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 4.59E-06 4.67E-08 mr1698 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 4.37E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 1.52E-07 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 1.59E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 7.92E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 3.65E-08 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121174382 NA 5.55E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251