\
| Variant ID: vg0121174382 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 21174382 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 99. )
TACAAAACTTATAATATATAAGAAATTATGAGTCAAAAATTAGTTTTAGAGACCATACCATGTTTGACCATGTCTAATATTATGGGATAGAGGAAGTACT[G/A,C]
TTACCTTCATCCCAAAATATAAAACCCAAGTATAAGATAGAACATTTTCTAGTACTACGAATCTGGACAGCCTAAGAAATGTCCCATACGGTATTATGGT
ACCATAATACCGTATGGGACATTTCTTAGGCTGTCCAGATTCGTAGTACTAGAAAATGTTCTATCTTATACTTGGGTTTTATATTTTGGGATGAAGGTAA[C/T,G]
AGTACTTCCTCTATCCCATAATATTAGACATGGTCAAACATGGTATGGTCTCTAAAACTAATTTTTGACTCATAATTTCTTATATATTATAAGTTTTGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 13.90% | 0.17% | 0.00% | C: 0.30% |
| All Indica | 2759 | 82.60% | 16.70% | 0.22% | 0.00% | C: 0.51% |
| All Japonica | 1512 | 98.30% | 1.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 43.90% | 56.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 67.10% | 32.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 86.50% | 11.80% | 0.33% | 0.00% | C: 1.31% |
| Indica Intermediate | 786 | 74.30% | 25.20% | 0.25% | 0.00% | C: 0.25% |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0121174382 | G -> A | LOC_Os01g37837.1 | upstream_gene_variant ; 1362.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> A | LOC_Os01g37837.3 | upstream_gene_variant ; 1362.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> A | LOC_Os01g37837.2 | upstream_gene_variant ; 1362.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> A | LOC_Os01g37832.1 | downstream_gene_variant ; 1721.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> A | LOC_Os01g37832.2 | downstream_gene_variant ; 1721.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> A | LOC_Os01g37832.3 | downstream_gene_variant ; 1721.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> A | LOC_Os01g37832-LOC_Os01g37837 | intergenic_region ; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> C | LOC_Os01g37837.1 | upstream_gene_variant ; 1362.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> C | LOC_Os01g37837.3 | upstream_gene_variant ; 1362.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> C | LOC_Os01g37837.2 | upstream_gene_variant ; 1362.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> C | LOC_Os01g37832.1 | downstream_gene_variant ; 1721.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> C | LOC_Os01g37832.2 | downstream_gene_variant ; 1721.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> C | LOC_Os01g37832.3 | downstream_gene_variant ; 1721.0bp to feature; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0121174382 | G -> C | LOC_Os01g37832-LOC_Os01g37837 | intergenic_region ; MODIFIER | silent_mutation | Average:50.989; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0121174382 | NA | 2.10E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 1.84E-06 | mr1095 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 8.89E-07 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 1.11E-07 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 2.80E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 4.93E-08 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 1.02E-08 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 2.49E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 6.04E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 3.18E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 2.28E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 8.19E-06 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | 4.59E-06 | 4.67E-08 | mr1698 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 4.37E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 1.52E-07 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 1.59E-07 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 7.92E-08 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 3.65E-08 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0121174382 | NA | 5.55E-09 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |