\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121087326:

Variant ID: vg0121087326 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 21087326
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGTTAACTATATTAATTAAGAGAGCAAAAGATGATGGTCAGAGATCTCTGGCTTGGTCCCACATTTAGTGGACGATGGTTTATCTATTTTACAATAT[G/A]
CTGATGATACTATTATTTTTCTAGAGCATGATTTAGAGAAATCAAAAAATATGAAGCTGTTATTAACTGCGTTTGAAAAACTTTCTGGCCTTAAGATAAA

Reverse complement sequence

TTTATCTTAAGGCCAGAAAGTTTTTCAAACGCAGTTAATAACAGCTTCATATTTTTTGATTTCTCTAAATCATGCTCTAGAAAAATAATAGTATCATCAG[C/T]
ATATTGTAAAATAGATAAACCATCGTCCACTAAATGTGGGACCAAGCCAGAGATCTCTGACCATCATCTTTTGCTCTCTTAATTAATATAGTTAACATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 2.50% 1.44% 4.40% NA
All Indica  2759 90.60% 1.20% 2.03% 6.20% NA
All Japonica  1512 98.60% 1.40% 0.00% 0.00% NA
Aus  269 61.00% 23.80% 3.72% 11.52% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 81.30% 1.70% 5.81% 11.18% NA
Indica III  913 93.90% 0.80% 0.88% 4.49% NA
Indica Intermediate  786 85.40% 2.00% 2.67% 9.92% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 2.20% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0121087326 G -> A LOC_Os01g37710.1 downstream_gene_variant ; 765.0bp to feature; MODIFIER silent_mutation Average:31.521; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0121087326 G -> A LOC_Os01g37710-LOC_Os01g37720 intergenic_region ; MODIFIER silent_mutation Average:31.521; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0121087326 G -> DEL N N silent_mutation Average:31.521; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0121087326 NA 1.42E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121087326 8.74E-06 1.89E-06 mr1399_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251