\
| Variant ID: vg0120773756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 20773756 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )
CTAGCTCTCTTAGCCGCTTATCGATCTTTTGTTATTTTATGGCTTTTATTGAATTTGGCTCTTCCTCTTCTTCAGTAGAGTTTATTTTATTTTGGATGGC[A/C]
ACCTGTGGTATTTCAAGGATCGGATAATCAGGTTGCCTACCTTGGATTTATTCGCGTTGGAGCAAGGCAAGTTATTATTCCTCCCCTTTGAGCATAATTA
TAATTATGCTCAAAGGGGAGGAATAATAACTTGCCTTGCTCCAACGCGAATAAATCCAAGGTAGGCAACCTGATTATCCGATCCTTGAAATACCACAGGT[T/G]
GCCATCCAAAATAAAATAAACTCTACTGAAGAAGAGGAAGAGCCAAATTCAATAAAAGCCATAAAATAACAAAAGATCGATAAGCGGCTAAGAGAGCTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.00% | 1.80% | 14.16% | 5.01% | NA |
| All Indica | 2759 | 66.00% | 2.50% | 23.02% | 8.41% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.13% | 0.07% | NA |
| Aus | 269 | 85.10% | 5.20% | 8.55% | 1.12% | NA |
| Indica I | 595 | 41.70% | 2.50% | 35.63% | 20.17% | NA |
| Indica II | 465 | 52.00% | 5.20% | 33.12% | 9.68% | NA |
| Indica III | 913 | 90.30% | 1.00% | 7.78% | 0.99% | NA |
| Indica Intermediate | 786 | 64.60% | 2.80% | 25.19% | 7.38% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 1.10% | 8.89% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0120773756 | A -> DEL | N | N | silent_mutation | Average:47.631; most accessible tissue: Minghui63 flag leaf, score: 88.342 | N | N | N | N |
| vg0120773756 | A -> C | LOC_Os01g37200.1 | downstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:47.631; most accessible tissue: Minghui63 flag leaf, score: 88.342 | N | N | N | N |
| vg0120773756 | A -> C | LOC_Os01g37180-LOC_Os01g37200 | intergenic_region ; MODIFIER | silent_mutation | Average:47.631; most accessible tissue: Minghui63 flag leaf, score: 88.342 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0120773756 | 3.23E-06 | NA | mr1120 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120773756 | 2.48E-07 | 2.11E-07 | mr1120 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |