RiceVarMap2

Detailed information for vg0120773756:

Variant ID: vg0120773756 (JBrowse)

Variation Type: SNP

Chromosome: chr01

Position: 20773756

Reference Allele: A

Alternative Allele: C

Primary Allele: A

Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGCTCTCTTAGCCGCTTATCGATCTTTTGTTATTTTATGGCTTTTATTGAATTTGGCTCTTCCTCTTCTTCAGTAGAGTTTATTTTATTTTGGATGGC[A/C]
ACCTGTGGTATTTCAAGGATCGGATAATCAGGTTGCCTACCTTGGATTTATTCGCGTTGGAGCAAGGCAAGTTATTATTCCTCCCCTTTGAGCATAATTA

Reverse complement sequence

TAATTATGCTCAAAGGGGAGGAATAATAACTTGCCTTGCTCCAACGCGAATAAATCCAAGGTAGGCAACCTGATTATCCGATCCTTGAAATACCACAGGT[T/G]
GCCATCCAAAATAAAATAAACTCTACTGAAGAAGAGGAAGAGCCAAATTCAATAAAAGCCATAAAATAACAAAAGATCGATAAGCGGCTAAGAGAGCTAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.00%	1.80%	14.16%	5.01%	NA
All Indica	2759	66.00%	2.50%	23.02%	8.41%	NA
All Japonica	1512	99.80%	0.00%	0.13%	0.07%	NA
Aus	269	85.10%	5.20%	8.55%	1.12%	NA
Indica I	595	41.70%	2.50%	35.63%	20.17%	NA
Indica II	465	52.00%	5.20%	33.12%	9.68%	NA
Indica III	913	90.30%	1.00%	7.78%	0.99%	NA
Indica Intermediate	786	64.60%	2.80%	25.19%	7.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	88.90%	1.10%	8.89%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0120773756	A -> DEL	N	N	silent_mutation	Average:47.631; most accessible tissue: Minghui63 flag leaf, score: 88.342	N	N	N	N
vg0120773756	A -> C	LOC_Os01g37200.1	downstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:47.631; most accessible tissue: Minghui63 flag leaf, score: 88.342	N	N	N	N
vg0120773756	A -> C	LOC_Os01g37180-LOC_Os01g37200	intergenic_region ; MODIFIER	silent_mutation	Average:47.631; most accessible tissue: Minghui63 flag leaf, score: 88.342	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0120773756	3.23E-06	NA	mr1120	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120773756	2.48E-07	2.11E-07	mr1120	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0120773756:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact