\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0120470627:

Variant ID: vg0120470627 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 20470627
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CATGGCTACTATAGATACAACCGTTGTTCACATCAAGATCAAGCCGTCCAAGTTCTGCAATCCAGTTCGGCCACCTGCTACAGTATCGACTTCAAACAGC[C/T,A]
GCCAAATATGCATGCGAGCTCCATTTTGGGTCCATGAGTACTTGATGGAAAGCTCTCGGAGTCATCTTTCCAATGGATCCAGCTTCATCACCAAATTCCA

Reverse complement sequence

TGGAATTTGGTGATGAAGCTGGATCCATTGGAAAGATGACTCCGAGAGCTTTCCATCAAGTACTCATGGACCCAAAATGGAGCTCGCATGCATATTTGGC[G/A,T]
GCTGTTTGAAGTCGATACTGTAGCAGGTGGCCGAACTGGATTGCAGAACTTGGACGGCTTGATCTTGATGTGAACAACGGTTGTATCTATAGTAGCCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 19.50% 0.66% 1.52% A: 0.06%
All Indica  2759 63.90% 32.60% 1.09% 2.39% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.00% A: 0.07%
Aus  269 93.30% 4.80% 0.00% 1.86% NA
Indica I  595 15.00% 84.70% 0.17% 0.17% NA
Indica II  465 71.60% 28.40% 0.00% 0.00% NA
Indica III  913 87.40% 4.50% 2.19% 5.91% NA
Indica Intermediate  786 69.20% 28.20% 1.15% 1.40% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.41% 0.00% A: 0.41%
VI/Aromatic  96 97.90% 0.00% 0.00% 0.00% A: 2.08%
Intermediate  90 88.90% 10.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0120470627 C -> T LOC_Os01g36790.1 upstream_gene_variant ; 1378.0bp to feature; MODIFIER silent_mutation Average:48.302; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0120470627 C -> T LOC_Os01g36800.1 upstream_gene_variant ; 2182.0bp to feature; MODIFIER silent_mutation Average:48.302; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0120470627 C -> T LOC_Os01g36790-LOC_Os01g36800 intergenic_region ; MODIFIER silent_mutation Average:48.302; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0120470627 C -> A LOC_Os01g36790.1 upstream_gene_variant ; 1378.0bp to feature; MODIFIER silent_mutation Average:48.302; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0120470627 C -> A LOC_Os01g36800.1 upstream_gene_variant ; 2182.0bp to feature; MODIFIER silent_mutation Average:48.302; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0120470627 C -> A LOC_Os01g36790-LOC_Os01g36800 intergenic_region ; MODIFIER silent_mutation Average:48.302; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0120470627 C -> DEL N N silent_mutation Average:48.302; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0120470627 NA 8.80E-14 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.68E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 3.75E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 2.55E-10 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 3.72E-09 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 9.91E-21 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 3.69E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 6.58E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 6.50E-06 2.62E-08 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 5.85E-06 2.47E-11 mr1100 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 2.47E-10 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.04E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 7.75E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.04E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 8.43E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 6.24E-07 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 8.25E-07 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 9.51E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 6.01E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.90E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 8.89E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 4.69E-08 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 2.82E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.19E-07 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.90E-07 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 2.42E-12 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 3.81E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.21E-12 mr1962 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 4.48E-15 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 9.22E-11 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 9.07E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 4.61E-11 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.57E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 6.58E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 6.25E-11 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 2.01E-12 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 8.35E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.54E-11 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 2.35E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 3.14E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.43E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 2.39E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 8.51E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.18E-10 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.63E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.27E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120470627 NA 1.11E-16 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251