\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0120457652:

Variant ID: vg0120457652 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 20457652
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCCGCCACGAGAAGATGAGAATTTAGAGTGTGCTTGCACCAATTGCTCGGGAGGTTTCGGCAAGGAGATGCCTAGACAACGTCTCCAAAAGGAGAGAA[G/A]
CGACAGAACACCGCCGCCACTGTTCTTTAAGGTCTCAAAGAGAGCCGAGACTGAGCTTTCGTTTGGCACCCACCCTTGAGGGGCGAGGCCGTTAGGTGTA

Reverse complement sequence

TACACCTAACGGCCTCGCCCCTCAAGGGTGGGTGCCAAACGAAAGCTCAGTCTCGGCTCTCTTTGAGACCTTAAAGAACAGTGGCGGCGGTGTTCTGTCG[C/T]
TTCTCTCCTTTTGGAGACGTTGTCTAGGCATCTCCTTGCCGAAACCTCCCGAGCAATTGGTGCAAGCACACTCTAAATTCTCATCTTCTCGTGGCGGCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 20.00% 0.19% 0.21% NA
All Indica  2759 66.50% 32.80% 0.33% 0.36% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 87.40% 12.60% 0.00% 0.00% NA
Indica I  595 15.30% 83.20% 0.67% 0.84% NA
Indica II  465 71.40% 28.40% 0.22% 0.00% NA
Indica III  913 93.60% 6.10% 0.00% 0.22% NA
Indica Intermediate  786 71.00% 28.10% 0.51% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0120457652 G -> A LOC_Os01g36780-LOC_Os01g36790 intergenic_region ; MODIFIER silent_mutation Average:71.96; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg0120457652 G -> DEL N N silent_mutation Average:71.96; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0120457652 NA 1.77E-42 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 4.97E-15 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 5.57E-14 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 3.17E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 3.10E-10 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 8.31E-09 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 2.23E-21 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 2.15E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 6.00E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 2.91E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 3.13E-10 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 9.08E-11 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 5.39E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 5.53E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 4.63E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 1.53E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 9.34E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 1.27E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 3.48E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 1.26E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 3.36E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 5.93E-07 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 1.51E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 8.64E-13 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 4.57E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 6.14E-12 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 6.48E-18 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 6.08E-13 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 9.93E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 8.51E-14 mr1075_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 1.25E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 9.28E-12 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 1.59E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 3.14E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 6.29E-12 mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 2.81E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 2.04E-14 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 4.62E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 2.73E-08 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 8.70E-12 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 2.25E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 1.29E-10 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 5.11E-07 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 3.39E-09 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 2.43E-10 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 5.09E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 7.94E-11 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 1.44E-08 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 3.44E-11 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 7.34E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120457652 NA 4.64E-17 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251