\
| Variant ID: vg0120417176 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 20417176 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 107. )
ACAACATGTTATCCGTGACAGAATGAACTACAATTTTGTTTTCTGCCTCCTTAAAACTTATAGAACATATTCATCTGTAATGGGTGGTCGGCACGCAAGG[T/C]
GGTGCACGGAGGGTGGGCTGTGGGTGGCGGTGCGGGACGTGGAGGCAGGAGCGGCGAACTCCGGGAGGGAGCCAGAGTTGTTAATAAATAAGAAGAAGAT
ATCTTCTTCTTATTTATTAACAACTCTGGCTCCCTCCCGGAGTTCGCCGCTCCTGCCTCCACGTCCCGCACCGCCACCCACAGCCCACCCTCCGTGCACC[A/G]
CCTTGCGTGCCGACCACCCATTACAGATGAATATGTTCTATAAGTTTTAAGGAGGCAGAAAACAAAATTGTAGTTCATTCTGTCACGGATAACATGTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 10.60% | 5.63% | 0.19% | NA |
| All Indica | 2759 | 94.40% | 2.00% | 3.59% | 0.00% | NA |
| All Japonica | 1512 | 61.40% | 28.20% | 9.85% | 0.60% | NA |
| Aus | 269 | 95.50% | 0.40% | 4.09% | 0.00% | NA |
| Indica I | 595 | 95.10% | 2.00% | 2.86% | 0.00% | NA |
| Indica II | 465 | 91.80% | 2.60% | 5.59% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.30% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 3.60% | 6.36% | 0.00% | NA |
| Temperate Japonica | 767 | 36.80% | 48.00% | 14.08% | 1.17% | NA |
| Tropical Japonica | 504 | 92.10% | 3.80% | 4.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 16.20% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 15.60% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0120417176 | T -> DEL | N | N | silent_mutation | Average:62.728; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0120417176 | T -> C | LOC_Os01g36760.1 | upstream_gene_variant ; 914.0bp to feature; MODIFIER | silent_mutation | Average:62.728; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0120417176 | T -> C | LOC_Os01g36750.1 | downstream_gene_variant ; 4920.0bp to feature; MODIFIER | silent_mutation | Average:62.728; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0120417176 | T -> C | LOC_Os01g36760-LOC_Os01g36766 | intergenic_region ; MODIFIER | silent_mutation | Average:62.728; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0120417176 | NA | 1.61E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | 4.30E-06 | 4.29E-06 | mr1011 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 1.13E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 3.71E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 9.26E-13 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 7.14E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | 3.37E-07 | 8.08E-15 | mr1650 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 2.14E-07 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 5.28E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 1.06E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 2.29E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 1.07E-07 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 2.24E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 1.75E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 1.01E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120417176 | NA | 2.46E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |