Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0120417176:

Variant ID: vg0120417176 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 20417176
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ACAACATGTTATCCGTGACAGAATGAACTACAATTTTGTTTTCTGCCTCCTTAAAACTTATAGAACATATTCATCTGTAATGGGTGGTCGGCACGCAAGG[T/C]
GGTGCACGGAGGGTGGGCTGTGGGTGGCGGTGCGGGACGTGGAGGCAGGAGCGGCGAACTCCGGGAGGGAGCCAGAGTTGTTAATAAATAAGAAGAAGAT

Reverse complement sequence

ATCTTCTTCTTATTTATTAACAACTCTGGCTCCCTCCCGGAGTTCGCCGCTCCTGCCTCCACGTCCCGCACCGCCACCCACAGCCCACCCTCCGTGCACC[A/G]
CCTTGCGTGCCGACCACCCATTACAGATGAATATGTTCTATAAGTTTTAAGGAGGCAGAAAACAAAATTGTAGTTCATTCTGTCACGGATAACATGTTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	10.60%	5.63%	0.19%	NA
All Indica	2759	94.40%	2.00%	3.59%	0.00%	NA
All Japonica	1512	61.40%	28.20%	9.85%	0.60%	NA
Aus	269	95.50%	0.40%	4.09%	0.00%	NA
Indica I	595	95.10%	2.00%	2.86%	0.00%	NA
Indica II	465	91.80%	2.60%	5.59%	0.00%	NA
Indica III	913	99.00%	0.30%	0.66%	0.00%	NA
Indica Intermediate	786	90.10%	3.60%	6.36%	0.00%	NA
Temperate Japonica	767	36.80%	48.00%	14.08%	1.17%	NA
Tropical Japonica	504	92.10%	3.80%	4.17%	0.00%	NA
Japonica Intermediate	241	75.50%	16.20%	8.30%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	15.60%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0120417176	T -> DEL	N	N	silent_mutation	Average:62.728; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0120417176	T -> C	LOC_Os01g36760.1	upstream_gene_variant ; 914.0bp to feature; MODIFIER	silent_mutation	Average:62.728; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0120417176	T -> C	LOC_Os01g36750.1	downstream_gene_variant ; 4920.0bp to feature; MODIFIER	silent_mutation	Average:62.728; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0120417176	T -> C	LOC_Os01g36760-LOC_Os01g36766	intergenic_region ; MODIFIER	silent_mutation	Average:62.728; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0120417176	NA	1.61E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	4.30E-06	4.29E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	1.13E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	3.71E-09	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	9.26E-13	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	7.14E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	3.37E-07	8.08E-15	mr1650	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	2.14E-07	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	5.28E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	1.06E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	2.29E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	1.07E-07	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	2.24E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	1.75E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	1.01E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120417176	NA	2.46E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251