| Variant ID: vg0120412875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 20412875 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )
ACCTTCTTTTTGTGATTTCGGCCGACTGGGATGGAATTTGGTGATGAAGCTAGATCCATTGGAAAGATGACTCCGAGAGCTTTCCATCAAGTACTCATGG[T/A]
CCCAAAATGGAGCTCGCATGCATATTTGGTGGCCGTTTAAAGTCGACACTGTAGCAGGTGGCCGAACTGGATTGTAGAACTTGGACGGCTTGATCTTGAT
ATCAAGATCAAGCCGTCCAAGTTCTACAATCCAGTTCGGCCACCTGCTACAGTGTCGACTTTAAACGGCCACCAAATATGCATGCGAGCTCCATTTTGGG[A/T]
CCATGAGTACTTGATGGAAAGCTCTCGGAGTCATCTTTCCAATGGATCTAGCTTCATCACCAAATTCCATCCCAGTCGGCCGAAATCACAAAAAGAAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 11.10% | 4.61% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 2.20% | 2.79% | 0.00% | NA |
| All Japonica | 1512 | 62.20% | 29.50% | 8.27% | 0.00% | NA |
| Aus | 269 | 95.50% | 1.50% | 2.97% | 0.00% | NA |
| Indica I | 595 | 94.80% | 2.20% | 3.03% | 0.00% | NA |
| Indica II | 465 | 93.10% | 2.80% | 4.09% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.30% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 4.10% | 4.45% | 0.00% | NA |
| Temperate Japonica | 767 | 38.70% | 50.50% | 10.82% | 0.00% | NA |
| Tropical Japonica | 504 | 92.10% | 3.80% | 4.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 16.60% | 8.71% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 14.40% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0120412875 | T -> A | LOC_Os01g36740.1 | upstream_gene_variant ; 3206.0bp to feature; MODIFIER | silent_mutation | Average:41.207; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg0120412875 | T -> A | LOC_Os01g36750.1 | downstream_gene_variant ; 619.0bp to feature; MODIFIER | silent_mutation | Average:41.207; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg0120412875 | T -> A | LOC_Os01g36760.1 | downstream_gene_variant ; 1441.0bp to feature; MODIFIER | silent_mutation | Average:41.207; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg0120412875 | T -> A | LOC_Os01g36750-LOC_Os01g36760 | intergenic_region ; MODIFIER | silent_mutation | Average:41.207; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0120412875 | NA | 1.17E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | 9.07E-07 | 9.06E-07 | mr1011 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | NA | 1.17E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | NA | 5.22E-13 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | NA | 1.49E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | 3.21E-06 | 9.10E-14 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | NA | 1.07E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | NA | 9.41E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | NA | 8.11E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120412875 | NA | 1.91E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/