Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0120412875:

Variant ID: vg0120412875 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 20412875
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTTCTTTTTGTGATTTCGGCCGACTGGGATGGAATTTGGTGATGAAGCTAGATCCATTGGAAAGATGACTCCGAGAGCTTTCCATCAAGTACTCATGG[T/A]
CCCAAAATGGAGCTCGCATGCATATTTGGTGGCCGTTTAAAGTCGACACTGTAGCAGGTGGCCGAACTGGATTGTAGAACTTGGACGGCTTGATCTTGAT

Reverse complement sequence

ATCAAGATCAAGCCGTCCAAGTTCTACAATCCAGTTCGGCCACCTGCTACAGTGTCGACTTTAAACGGCCACCAAATATGCATGCGAGCTCCATTTTGGG[A/T]
CCATGAGTACTTGATGGAAAGCTCTCGGAGTCATCTTTCCAATGGATCTAGCTTCATCACCAAATTCCATCCCAGTCGGCCGAAATCACAAAAAGAAGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	11.10%	4.61%	0.00%	NA
All Indica	2759	95.00%	2.20%	2.79%	0.00%	NA
All Japonica	1512	62.20%	29.50%	8.27%	0.00%	NA
Aus	269	95.50%	1.50%	2.97%	0.00%	NA
Indica I	595	94.80%	2.20%	3.03%	0.00%	NA
Indica II	465	93.10%	2.80%	4.09%	0.00%	NA
Indica III	913	99.10%	0.30%	0.55%	0.00%	NA
Indica Intermediate	786	91.50%	4.10%	4.45%	0.00%	NA
Temperate Japonica	767	38.70%	50.50%	10.82%	0.00%	NA
Tropical Japonica	504	92.10%	3.80%	4.17%	0.00%	NA
Japonica Intermediate	241	74.70%	16.60%	8.71%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	14.40%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0120412875	T -> A	LOC_Os01g36740.1	upstream_gene_variant ; 3206.0bp to feature; MODIFIER	silent_mutation	Average:41.207; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg0120412875	T -> A	LOC_Os01g36750.1	downstream_gene_variant ; 619.0bp to feature; MODIFIER	silent_mutation	Average:41.207; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg0120412875	T -> A	LOC_Os01g36760.1	downstream_gene_variant ; 1441.0bp to feature; MODIFIER	silent_mutation	Average:41.207; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N
vg0120412875	T -> A	LOC_Os01g36750-LOC_Os01g36760	intergenic_region ; MODIFIER	silent_mutation	Average:41.207; most accessible tissue: Minghui63 flag leaf, score: 68.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0120412875	NA	1.17E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	9.07E-07	9.06E-07	mr1011	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	1.17E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	5.22E-13	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	1.49E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	3.21E-06	9.10E-14	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	1.07E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	9.41E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	8.11E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	1.91E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	5.26E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	5.99E-06	2.36E-13	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	1.79E-08	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	5.98E-16	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	8.41E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	8.87E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120412875	NA	6.21E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251