\
| Variant ID: vg0120180517 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 20180517 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATGTGGCCGAGGTGCTACTATCAAAACCATGCACCCCAAGCCCAGCCTAAAACCATTTTGAGAGTTTTGAATAGAGGGAAAGGTGTGCATCCAATTCCAC[A/C]
ATAGTCCAACCATTCCATAAAGTCCAAGAGATATGAATATTCCCAAAGTCTAAAATTATAAAACCACCTAATGTTGTCTTTTTAATCAGCGAAGCATCTA
TAGATGCTTCGCTGATTAAAAAGACAACATTAGGTGGTTTTATAATTTTAGACTTTGGGAATATTCATATCTCTTGGACTTTATGGAATGGTTGGACTAT[T/G]
GTGGAATTGGATGCACACCTTTCCCTCTATTCAAAACTCTCAAAATGGTTTTAGGCTGGGCTTGGGGTGCATGGTTTTGATAGTAGCACCTCGGCCACAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.90% | 7.50% | 3.17% | 5.46% | NA |
| All Indica | 2759 | 89.40% | 0.50% | 3.26% | 6.81% | NA |
| All Japonica | 1512 | 70.20% | 21.70% | 3.51% | 4.56% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 68.60% | 0.20% | 9.08% | 22.18% | NA |
| Indica II | 465 | 93.30% | 1.10% | 2.80% | 2.80% | NA |
| Indica III | 913 | 99.00% | 0.10% | 0.44% | 0.44% | NA |
| Indica Intermediate | 786 | 91.70% | 0.90% | 2.42% | 4.96% | NA |
| Temperate Japonica | 767 | 93.00% | 5.50% | 1.43% | 0.13% | NA |
| Tropical Japonica | 504 | 36.90% | 43.70% | 7.54% | 11.90% | NA |
| Japonica Intermediate | 241 | 67.60% | 27.40% | 1.66% | 3.32% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 11.10% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0120180517 | A -> DEL | N | N | silent_mutation | Average:32.951; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0120180517 | A -> C | LOC_Os01g36370.1 | downstream_gene_variant ; 3403.0bp to feature; MODIFIER | silent_mutation | Average:32.951; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0120180517 | A -> C | LOC_Os01g36370-LOC_Os01g36380 | intergenic_region ; MODIFIER | silent_mutation | Average:32.951; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0120180517 | NA | 7.76E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 3.10E-07 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 2.00E-10 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 7.54E-12 | mr1248 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 5.90E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 6.45E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 8.63E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 4.15E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 4.77E-14 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120180517 | NA | 2.06E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |